--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (7531 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1188       1348   0    Initial    161    96   Excellent
gagaggttccccggtgtcccgacggcggctcaagtcagagttgctgggttttgctcagat
tggtgtgggaagagcctgcctgtggggagcggccactccatactgctgaggcctcaggac
tgctgctcagcttgcccgttacctgaagaggcggcggagccgggcccctgaccggtcacc
ATGTGGGCCTTCTCGGAATTGCCCATGCCGCTGCTGATCAATTTGATCGTCTCGCTGCTG
GGATTTGTGGCCACAGTCACCCTCATCCCGGCCTTCCGGGGCCACTTCATTGCTGCGCGC
CTCTGTGGTCAGGACCTCAACAAAACCAGCCGACAGCAGAT
gtgagcagcggcacacgggtccgggcagggggcaagggctaaggaaggagtggctagggc
aggggcgggaaccggggtgcttgaccacacgtgaagactcagaactaacccaggcagcct
ggaactcggagaggtgatgagcagaacttactcgcattggggaaaggatgggtagggacc

Exon  2 +       1705       1825   2   Internal    121    85        Good
gacccttgggtatatctgggactctggcagtggtgctttcctccctccgcccccctcacc
acttaccagaataaaaaaccgggaatgagaagaccactttgggttactgtaacacctgca
ctagtgagtgaccacgccccctttcctcttccccctcgcccccttgctgctgggccacag
CCCAGAATCCCAGGGAGTGATCAGCGGTGCTGTTTTCCTTATCATCCTCTTCTGCTTCAT
CCCTTTCCCCTTCCTGAACTGCTTTGTGAAGGAGCAGTGTAAGGCATTCCCCCACCATGA
A
gtaagtgggttcgtgggggtgattgcctgtggctgggacctgggaggtacctgagagaac
tggggttatttgggcttgtggggaggggctaagaaattatcagaaaagacaggaattctt
aaaaggtggaatgggagcaggcttgagtcatggacctgcccgagcctcccccagtttgtg

Exon  3 +       2000       2167   0   Internal    168    87        Good
catgaagtaagtgggttcgtgggggtgattgcctgtggctgggacctgggaggtacctga
gagaactggggttatttgggcttgtggggaggggctaagaaattatcagaaaagacagga
attcttaaaaggtggaatgggagcaggcttgagtcatggacctgcccgagcctcccccag
TTTGTGGCCCTGATAGGTGCCCTCCTTGCCATCTGCTGCATGATCTTCCTGGGCTTTGCG
GATGATGTACTGAATCTGCGCTGGCGCCATAAGCTGCTGCTACCTACAGCTGCCTCACTA
CCTCTCCTCATGGTCTATTTCACCAACTTTGGCAACACGACCATTGTG
gtgcccaagcccttccgcccgatacttggcctgcatctggacttgggtaggtagtcctac
cactgctgcccctatggcacctacttcagggaacccttcctggtgctccacattctcctc
caagtgttccttttttgtctctgtgtcttcccagatcctttctggtagcccttcatccta

Exon  4 +       2398       2585   0   Internal    188   100   Excellent
gtagtcctaccactgctgcccctatggcacctacttcagggaacccttcctggtgctcca
cattctcctccaagtgttccttttttgtctctgtgtcttcccagatcctttctggtagcc
cttcatcctatcgtccgtcctcaccacttttctaaaaattcttaaatcctcctcccctag
GTGGCACTACTTCTTTTCCTACCATCTCTCCCCGCAGGAATCCTGTACTATGTCTACATG
GGGCTGCTGGCAGTGTTCTGTACCAATGCCATCAATATCCTAGCAGGAATTAACGGCCTA
GAGGCTGGCCAGTCACTAGTCATTTCTGCTTCCATCATTGTCTTCAACCTGGTAGAGTTG
GAAGGTAG
gtgggattgggggtggggagagagaagtctgagtgttaaaggtgtggcctgatatatgac
tttgggaaattcaggggaaaaaagcaatatgcatagtaattatagaagataagggaagct
acttactttgcaaataacaatgcagatttattaaaagtgagaaagaaaaatagtagccct

Exon  5 +       4800       4988   2   Internal    189    95   Excellent
gtggaggccccaggaatagatgaattcagggccttggatcctgcagagttgctgcacaac
tggagtctcctctgagtcagaactagggtcagggctagtccagtgcccatagggtgtgat
gtgagagaagggattggtaatgcctcttgccactggctcggatcctcttcccccacacag
GTACCCATCACGGGTGTTTGTGGGAGATACCTTCTGTTACTTTGCTGGCATGACCTTTGC
CGTGGTGGGCATCTTGGGACACTTCAGCAAGACCATGCTACTATTCTTCATGCCCCAGGT
GTTCAACTTCCTCTACTCACTGCCTCAGCTCCTGCATATCATCCCCTGCCCTCGCCACCG
CATACCCAG
gtagccgctttttggcttgaaatggacatcatagccttttcacttgggatatctaatgcc
agcctatacatttgctgtgcaaagggagtgggcccaaagaagggctatttccatgtgagt
agccctttataacttacaaagcacatttatttgcataatctgctacagtggttctgataa

Exon  6 +       5292       5379   2   Internal     88    66    Marginal
cctttataacttacaaagcacatttatttgcataatctgctacagtggttctgataacag
taagcagcagagccagaaatagatctcaggttgactccacattcaatgctcttcctatta
gccacagggaggagggttcaaatagtggcccagtcacatgaagctatcttccccccgcag
ACTCAATATCAAGACAGGCAAACTGGAGATGAGCTATTCCAAGTTCAAGACCAAGAGCCT
CTCTTTCTTGGGCACCTTTATTTTAAAG
gtaacagggtaacaaggaggtaaggccctaggctgccatcctgaccttgaggaatgggga
acctagtcctacatcagatccaaggggaacttgaaagcattaaatagatccacattccta
aagcataggtattagctgaggttctcttcacctctggtccctccaggtggcagagagcct

Exon  7 +       5546       5845   0   Terminal    300   100   Excellent
cctttattttaaaggtaacagggtaacaaggaggtaaggccctaggctgccatcctgacc
ttgaggaatggggaacctagtcctacatcagatccaaggggaacttgaaagcattaaata
gatccacattcctaaagcataggtattagctgaggttctcttcacctctggtccctccag
GTGGCAGAGAGCCTCCAGCTGGTGACAGTACACCAGAGTGAGACTGAAGATGGTGAATTC
ACTGAATGTAACAACATGACCCTCATCAACTTGCTACTTAAAGTCCTTGGGCCCATACAT
GAGAGAAACCTCACATTGCTCCTGCTGCTGCTGCAGGTGAGGATGGGAATCGAGTTTATA
CCTCCGTGTCTCCCTTTCTGCGTGATTCTTACTCCAGTCCATTTCTCCTTGCAGATCCTG
GGCAGTGCCATCACCTTCTCCATTCGATATCAGCTCGTTCGACTCTTCTATGATGTCTGA

gtcccttgatcattgtcctttacctcacagtctctaggattcctgactcaggctgacctc
tctctctggtcccagactgcctccttgcccaggcctctctcactcttcatactcctccag
attttgttctcagcattttcctttctctgtgatcattggcatcctgggcgtttcttgccc

Exon  8 +       5780       5845   0   Terminal     66    93   Excellent
gaattcactgaatgtaacaacatgaccctcatcaacttgctacttaaagtccttgggccc
atacatgagagaaacctcacattgctcctgctgctgctgcaggtgaggatgggaatcgag
tttatacctccgtgtctccctttctgcgtgattcttactccagtccatttctccttgcag
ATCCTGGGCAGTGCCATCACCTTCTCCATTCGATATCAGCTCGTTCGACTCTTCTATGAT
GTCTGA
gtcccttgatcattgtcctttacctcacagtctctaggattcctgactcaggctgacctc
tctctctggtcccagactgcctccttgcccaggcctctctcactcttcatactcctccag
attttgttctcagcattttcctttctctgtgatcattggcatcctgggcgtttcttgccc

--------------------------------------------------------------------------------