--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (7507 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1291       1503   0    Initial    213    64    Marginal
tgcgcgccccacgtgcctcctgtaaacaagagaacgcgcaggcgccgcaaaccagcgccc
attggtcggcgtgccgtcgccccgctggagggaggactcaggccccgctggccgcgggct
cggtacccggtgggtcggtggagcgtctgttgggtccgggccgccggcttcgccctcgcc
ATGGCGCCCTGGCTGCAGCTCCTGTCGCTGCTGGGGCTGCTCCCGGGCGCAGTGGCCGCC
CCCGCCCAGCCCCGAGCCGCCAGCTTTCAGGCCTGGGGGCCGCCGTCCCCGGAGCTGCTG
GCGCCCACCCGCTTCGCGCTGGAGATGTTCAACCGCGGCCGGGCTGCGGGGACGCGGGCC
GTGCTGGGCCTTGTGCGCGGCCGCGTCCGCCGG
gtgaggacgcgccgggggcgggggcgccaggcccgggtccaagggataggagctttgacc
taacattgggatggggcctgcccgctggacgaaccgatctctggtgatggggaatgggca
gcgccgcacgggcggggccttgggcgccgtcaagggccgactgtgcccgcctcacctact

Exon  2 +       1695       1793   0   Internal     99    99   Excellent
ccgggggcgggggcgccaggcccgggtccaagggataggagctttgacctaacattggga
tggggcctgcccgctggacgaaccgatctctggtgatggggaatgggcagcgccgcacgg
gcggggccttgggcgccgtcaagggccgactgtgcccgcctcacctactcctctctccag
GCGGGTCAGGGGTCGCTGTACTCCCTGGAGGCCACCCTGGAGGAGCCACCCTGCAACGAC
CCCATGGTGTGCCGGCTCCCCGTGTCCAAGAAAACCCTG
gtgagtgatgaggctcttggggttccccgccccgaggccgagtaaagcagcagttggatg
atgacgggtcaggtcaagacgcagggatctgaggtagctgctgccccaccttgagccact
tcccaggccccgagggctggaaaccaagatgctatgaaggggaggatgccccggtgcagg

Exon  3 +       2115       2333   0   Internal    219    96   Excellent
aaccaagatgctatgaaggggaggatgccccggtgcaggccgtgcctcactgtccactgt
gatggggtgattgccttaggggtggctctcatctgaggagcctccagctccatcttggcc
agatcttgctccccagatccagatccaggcccccagagcagcttcttcctctccctccag
CTCTGCAGCTTCCAAGTCCTGGATGAGCTCGGAAGACACGTGCTGCTGCGGAAGGACTGT
GGCCCAGTGGACACCAAGGTTCCAGGTGCTGGGGAGCCCAAGTCAGCCTTCACTCAGGGC
TCAGCCATGATTTCTTCTCTGTCCCAAAACCATCCAGACAACAGAAACGAGACTTTCAGC
TCAGTCATTTCCCTGTTGAATGAGGATCCCCTGTCCCAG
gtgaggagccctcagcttgaggagccctcagcttgaggagccagccgctgcctcatcacc
cttctcccttccctctggagtgggtttctctggtcagcctaaagactggtctgcctatcc
aggacttgcctgtgaagatggcttcaatcttcaagaactttgtcattacctataaccgga

Exon  4 +       2456       2531   0   Internal     76    95   Excellent
cagaaacgagactttcagctcagtcatttccctgttgaatgaggatcccctgtcccaggt
gaggagccctcagcttgaggagccctcagcttgaggagccagccgctgcctcatcaccct
tctcccttccctctggagtgggtttctctggtcagcctaaagactggtctgcctatccag
GACTTGCCTGTGAAGATGGCTTCAATCTTCAAGAACTTTGTCATTACCTATAACCGGACA
TATGAGTCAAAGGAAG
gtgaggacccagccttggctgtacctgttcctatcagaacaggactttccccccaacttg
gcaccttggtgtgtgggaggagaaagacaagaggcagtgtacctgttcaaggaccccata
attcctgagctctccctaagccttcccagcctggcagccaccctgagtacctggcccctt

Exon  5 +       3373       3682   1   Internal    310    99   Excellent
ctgggaagtcatcacttcagtttggccctaaaagttgatcagacctcccactccatcact
tgcatgtctggcccccacccctacctgctccccggggaaacccctgcctgctagccccaa
ttgcccttccttttatctgcctggggtcgaacccctcctcttctgctccttggtcctcag
AAGCCCGGTGGCGCCTGTCCGTCTTTGTCAATAACATGGTGCGAGCACAGAAGATCCAGG
CCCTGGACCGTGGCACAGCTCAGTATGGAGTCACCAAGTTCAGTGATCTCACAGGTAGGG
ATAGTGGCCACAGTCCTCATGGATCCAGGAAGAGACAGGACCTTGCTCGCAAGGCCTCTG
GTCAGGTCTGGCTTAGAACACTCTTCCTCCCCATGCCCTGCCCACCTTTGCCCGCAGAGG
AGGAGTTCCGCACTATCTACCTGAATACTCTCCTGAGGAAAGAGCCTGGCAACAAGATGA
AGCAAGCCAA
gtctgtgggtgacctcgccccacctgaatgggactggaggagtaagggggctgtcacaaa
agtcaaagaccaggttggacccctggaagtgagggtgggacatgggcactgcactggggc
tgacgaaggggcccggctctgactccaactccacccatctcttgtagggcatgtgtggct

Exon  6 +       3610       3770   1   Internal    161   100   Excellent
aggccctggaccgtggcacagctcagtatggagtcaccaagttcagtgatctcacaggta
gggatagtggccacagtcctcatggatccaggaagagacaggaccttgctcgcaaggcct
ctggtcaggtctggcttagaacactcttcctccccatgccctgcccacctttgcccgcag
AGGAGGAGTTCCGCACTATCTACCTGAATACTCTCCTGAGGAAAGAGCCTGGCAACAAGA
TGAAGCAAGCCAAGTCTGTGGGTGACCTCGCCCCACCTGAATGGGACTGGAGGAGTAAGG
GGGCTGTCACAAAAGTCAAAGACCAGGTTGGACCCCTGGAA
gtgagggtgggacatgggcactgcactggggctgacgaaggggcccggctctgactccaa
ctccacccatctcttgtagggcatgtgtggctcctgctgggccttctcagtcacaggcaa
tgtggagggccagtggtttctcaaccaggggaccctgctctccctctctgaacagggtga

Exon  7 +       3946       4106   2   Internal    161    84        Good
tggaagtgagggtgggacatgggcactgcactggggctgacgaaggggcccggctctgac
tccaactccacccatctcttgtagggcatgtgtggctcctgctgggccttctcagtcaca
ggcaatgtggagggccagtggtttctcaaccaggggaccctgctctccctctctgaacag
GGTGAGCATCTCGCTCTACTCCTCTGTCCCCAGCCTAGCCCCTCAGGAGGGCTTCTTGGG
ACCAGCCTTCTGTCTCCTAGAGCTCTTGGACTGTGACAAGATGGACAAGGCCTGCATGGG
CGGCTTGCCCTCCAATGCCTACTCGGCCATAAAGAATTTGG
gtatgcattaatggggtcaggaggggcaaccggagccacttctccctgtacaagaagtta
cttcataatgggggggagacatgagcatgagagttacacagaactgggtccaggtcttaa
tgctgacccagccaggcgtggtggctcatgcctgtaattccaacactttgggaggccaac

Exon  8 +       4771       4890   1   Internal    120   100   Excellent
ccccatctctcccagcctcagatgtgtcatttctagaatgaagacattcttcagagggga
tggcctgtggcctggggtggacgaggaatgtgaaacctcgcgtagagggcttagttcatt
tctggctgtgaatggcaaatgggagcctgcccttctctactcacccccaccgttccccag
GAGGGCTGGAGACAGAGGATGACTACAGCTACCAGGGTCACATGCAGTCCTGCAACTTCT
CAGCAGAGAAGGCCAAGGTCTACATCAATGACTCCGTGGAGCTGAGCCAGAACGAGCAGA

gtgagtgaggggcagggtgaggtgaggtcaggtggggccggggcctgggtgcctactgat
gccaccccttcccatctcagagctggcagcctggctggccaagagaggcccaatctccgt
ggccatcaatgcctttggcatgcaggtgaggccctagccccactgcccctgccccatctc

Exon  9 +       4971       5035   1   Internal     65    94   Excellent
gactacagctaccagggtcacatgcagtcctgcaacttctcagcagagaaggccaaggtc
tacatcaatgactccgtggagctgagccagaacgagcagagtgagtgaggggcagggtga
ggtgaggtcaggtggggccggggcctgggtgcctactgatgccaccccttcccatctcag
AGCTGGCAGCCTGGCTGGCCAAGAGAGGCCCAATCTCCGTGGCCATCAATGCCTTTGGCA
TGCAG
gtgaggccctagccccactgcccctgccccatctcttgttgacctccccgacctcttctt
ggagtcgatcccctactccttctccacctccagttttaccgccacgggatctcccgccct
ctccggcccctctgcagcccttggctcattgaccatgcggtgttgcttgtgggctacggc

Exon 10 +       5129       5219   0   Internal     91    84        Good
atgccaccccttcccatctcagagctggcagcctggctggccaagagaggcccaatctcc
gtggccatcaatgcctttggcatgcaggtgaggccctagccccactgcccctgccccatc
tcttgttgacctccccgacctcttcttggagtcgatcccctactccttctccacctccag
TTTTACCGCCACGGGATCTCCCGCCCTCTCCGGCCCCTCTGCAGCCCTTGGCTCATTGAC
CATGCGGTGTTGCTTGTGGGCTACGGCAACC
gtgagttccgctgcctgtcctgcatccagccaggccacaggcaggggtgggatcacagca
tctcaggtcctctagaggggaaatagggggaatgcctaggaaccctgtccttacccactg
cctgggccatgaccagctgggcatcatctgtcctctctatggcagggaagctgagctgtg

Exon 11 +       5770       5844   0   Terminal     75    54    Marginal
aattaaggaccctgatccttgcgctctgcactgcaccccaggctctgacgttcccttttg
ggccatcaagaacagctggggcactgactggggtgagaaggtgagtcttgctggcttggc
ccctggccctccagccgccatcctaccctggtgccctcaccagctccccctctcccccag
GGTTACTACTACTTGCATCGTGGGTCCGGGGCCTGTGGCGTGAACACCATGGCCAGCTCG
GCGGTGGTGGACTGA
agaggggcccccagctcgggacctggtgctgatcagagtggctgctgccccagcctgaca
tgtgtccaggcccctccccgggaggtacagctggcagagggaaaggcactgggtacctca
gggtgagcagagggcactgggctggggcacagcccctgcttccctgcaccccattcccac

--------------------------------------------------------------------------------