--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (12160 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        967       1032   2   Internal     66    53    Marginal
gctaggtattattattcccattttacagaggaagaaactgaggcacgggaaagttcagca
acaagcccaaggtcacacacctacttatgagggagtcaggcagtcttcaccccagagcca
gctgatctctagatgggactgaagactggaccacttggaccattttctttccaacaacag
GGCTAAAGTAGCTGATGAAGCCATGGCGCCCCCATGGACTTCTTTGTCCAGCTTTGCCAG
TGACCT
gtgaggtcaccttggtctagtccttcccttttcttgacctcggtttcctcatttacaatg
aaggagtttgacacaataattcttgattccgaactatagcccaggaagaggcatttggga
atgaggccctggcctgctggtgacatcatagaggggagagttccacgagaatagtcaggc

Exon  2 +       1433       1695   2   Internal    263    65    Marginal
ctcaggaaagaagggaaatccaggcggggcctgttgggcccaggtcttgagctcttttgg
ctccagagttcccagcacagtcatggatcaaaactcagtgcctgaaaaggctcagaatga
ggcagacaccaataacgcagataggttctttcgctctcactcatcacccccacaccacag
GCCAGGCCACAGCAGAGCTCTCCACCATTACGAGTTGCACCATCACGGCGTGCCCCACCA
ACGTGGTGAATCTCACCACCCTCCGGAGTTCCAAGACTTCCACGACCAAGCCTTGTCCTC
CCATGTCCACCAATCTCACCACCACAGCGAGGCACGGAATCACGGCAGAGCCCATGGCCC
CACAGGCTTTGGTCTGGCTCCCTCTCAAGGCGCCGTCCCCTCCCACCGTTCCTACGGTGA
GGACTACCATGATGAGCTCCAAC
gtgatggcaggaggcatcatgatgggtcccaatacggtgggttccatcagcagagtgact
cccattaccatagggggtctcaccatggcagaccccaatatctcggtgagaatttatccc
actattcctctggcgtgccccaccacggtgaggcttcccaccatggtgggtcctacctcc

Exon  3 +       1934       2157   1   Internal    224    79        Good
ctcccattaccatagggggtctcaccatggcagaccccaatatctcggtgagaatttatc
ccactattcctctggcgtgccccaccacggtgaggcttcccaccatggtgggtcctacct
cccccatggacccaatccctacagtgagtccttccaccacagcgaggcttcccaccttag
CGGGCTCCAACACGATGAGTCCCAGCATCACCAAGTCCCCCACCGTGGCTGGCCCCACCA
TCACCAAGTCCACCACCATGGCAGGTCCCGTCATCATGAAGCCCACCAGCATGGAAAGTC
TCCTCATCACGGAGAGACCATTTCCCCTCATTCCTCTGTGGGGTCCTACCAGCGTGGGAT
ATCTGACTATCACAGCGAGTACCACCAAGGTGATCACCACCCCA
gtgagtaccaccatggcgaccatccccaccacacacagcaccactaccaccagacccacc
ggcaccgagactaccatcagcaccaagaccaccacggcgcgtatcattccagttacctcc
atggcgactacgtccagagcacttcccaactctctatcccacacacatcccggagcctga

Exon  4 +       2463       2550   0   Internal     88    69    Marginal
gactacgtccagagcacttcccaactctctatcccacacacatcccggagcctgattcac
gatgcccccggccctgctgcttctcgtacaggagtcttcccctatcacgtagcacaccca
cggggctcggctcacagcatgactcggtcctccagcacaatccgctcacgtgtcacccag
ATGTCCAAAAAAGTCCATACCCAGGATATCTCCACCAAACATTCAGAAGACTGGGGCAAA
GAAGAAGGGCAATTTCAGAAACGCAAAA
gtgagtctttgctgggccccccatgccaactcctgctgcctggcgcaggatccagacctg
atctcggccccgcactgtccttccgcagatcgtaaggcccgaccctcctgcacaggtccc
ccactggctattcactctcctgactgttcatggtcccatcttttattccttgaattatgt

Exon  5 +       4653       4865   1   Internal    213   100   Excellent
ggcaggcacctgcagtcccagctacttgggaggctgaggcacaagagttgcttgaacccg
ggaggcagagggccagcaagcaggcaggagtgaccatggacgctgagccaggctgggggg
tgcctgggacctcgtgtcccctcttgcacacacttgactttctggccctgttcctttcag
CCGGCCGGCTCCAGCGGACCCGCAAGAAGGGACACTCTACCAATCTCTTCCAGTGGCTGT
GGGAAAAGCTAACCTTCCTCATTCAGGGCTTCCGGGAAATGATCCGGAACCTGACCCAAT
CCTTGGCCTTTGAAACTTTCATCTTCTTCGTTGTCTGCCTCAACACCGTCATGCTGGTGG
CCCAGACCTTCGCTGAAGTCGAGATCCGGGGCG
gtaagagccagggagtcctgttcccatggagaagccaccgatgctcttccaggacctccg
tgggcctgatccagtgccgggcggtttataggactcagctcacttgatcctcacccctgg
gaagtagatggccttacccagtattagagagcgtctcagaaagaccccgctgaggccggc

Exon  6 +       5835       5948   1   Internal    114   100   Excellent
acacaattatccccattttaaagacaagaaaactgagacacagcagtagtgaagtcgcgc
agctgcttacgcagagccggggagagcctgggaatctgggcttgtgtgaggctaatgctg
aggagagagagggcactgggtgctggggacagctctgagtgcacccctgtgttcctgcag
AGTGGTACTTCATGGCCTTGGACTCCATATTCTTCTGCATCTACGTGGTGGAAGCCCTGC
TCAAGATCATCGCCCTGGGCCTCTCGTACTTCTTTGACTTCTGGAACAATTTGG
gtgggtgcggccggggccaggctgcgtgtgtttagtctgggggaggctcgggacgagaga
aggatggggaagggggcgctggcgttgggagcccgccaggctcaggcaccccgtgccctc
agacttcttcattatggccatggccgtgctggacttcttgctgatgcagacccactcctt

Exon  7 +       6071       6218   1   Internal    148    98   Excellent
ctgctcaagatcatcgccctgggcctctcgtacttctttgacttctggaacaatttgggt
gggtgcggccggggccaggctgcgtgtgtttagtctgggggaggctcgggacgagagaag
gatggggaagggggcgctggcgttgggagcccgccaggctcaggcaccccgtgccctcag
ACTTCTTCATTATGGCCATGGCCGTGCTGGACTTCTTGCTGATGCAGACCCACTCCTTCG
CCATCTACCACCAAAGCCTCTTCCGGATCCTCAAGGTCTTCAAGAGCCTGCGGGCCCTGA
GGGCAATCCGGGTCCTGCGGAGGCTCAG
gtcagtggccacggctcccacctggggtggggactccaaaggaagaggggacacagacca
gggccccaaagaaatccactgtgacctgctcaagggatgggggcgcaggaggctgctgac
cccagcctgcttctgccttctgtcatgcactggaatcagccccttcatttttccagagag

Exon  8 +       6529       6628   2   Internal    100   100   Excellent
ttctgccttctgtcatgcactggaatcagccccttcatttttccagagaggggccaggac
tcacccaagtcaccaacaagtcaggagcctcctgccttcagcgccagctgtggctgctgg
gcagagacacacacccccgcccctcaccgatgactcagtccccactccttctgcccacag
CTTCCTGACCAGCGTCCAGGAAGTGACAGGGACCCTGGGCCAGTCCTTGCCGTCCATCGC
AGCCATCCTCATCCTCATGTTTACCTGCCTCTGTATCCTG
gtgctgcaggggctggggtgggggcctgaggggctgcggtgaaaggggtgcggggagcag
ggatggggcaggacgaggggcgctggggtggggatagcactggagagctgagtttggccc
tgaacagccagtcctcttctccgcggtcctccgggcactgttccgcaaatctgaccccaa

Exon  9 +       6819       7150   0   Internal    332    60    Marginal
ggctggggtgggggcctgaggggctgcggtgaaaggggtgcggggagcagggatggggca
ggacgaggggcgctggggtggggatagcactggagagctgagtttggccctgaacagcca
gtcctcttctccgcggtcctccgggcactgttccgcaaatctgaccccaagcgcttccag
AACATCTTCACCACCATCTTCACCCTCTTCACCTTGCTCACGCTGGATGACTGGTCCCTC
ATCTACATGGACAGCCGTGCCCAGGGTAGGGCAGGCCCCAGGCTGCAGGGAGGGCCGGGG
ATTGGCGGGGTGGACCGGCCAGGGCTCAGTGACCCCATCGGCAAAGTGGGGCTTCTGATG
CCTGCATGTCCGGGTATGGGAAGGGAGCAGGTCGTGGTTGGGGGTGGCGAGCACAGCCTG
ACTGTGCCCTCTGGCCTGCTCCCCCTAGGCGCCTGGTACATCATTCCCATCCTCGTAATT
TACATCATCATCCAGTACTTCATCTTCCTCAA
gtgaggactcacccctgctctgctgcccagcaccacccacacttcctcctctcccctggg
acccttaccccagccctctcaccctggtcatgccacgctgaacccacaagaagtaccggg
tgcccctctcctctggcctcctcgctgagggcacacccctgtccctctccccagcctggt

Exon 10 +       7087       7150   1   Internal     64    82        Good
gggcaggccccaggctgcagggagggccggggattggcggggtggaccggccagggctca
gtgaccccatcggcaaagtggggcttctgatgcctgcatgtccgggtatgggaagggagc
aggtcgtggttgggggtggcgagcacagcctgactgtgccctctggcctgctccccctag
GCGCCTGGTACATCATTCCCATCCTCGTAATTTACATCATCATCCAGTACTTCATCTTCC
TCAA
gtgaggactcacccctgctctgctgcccagcaccacccacacttcctcctctcccctggg
acccttaccccagccctctcaccctggtcatgccacgctgaacccacaagaagtaccggg
tgcccctctcctctggcctcctcgctgagggcacacccctgtccctctccccagcctggt

Exon 11 +       7325       7444   2   Internal    120    96   Excellent
cctcaagtgaggactcacccctgctctgctgcccagcaccacccacacttcctcctctcc
cctgggacccttaccccagccctctcaccctggtcatgccacgctgaacccacaagaagt
accgggtgcccctctcctctggcctcctcgctgagggcacacccctgtccctctccccag
CCTGGTGATTACTGTCCTGGTGGATAGCTTCCAGACGGCGCTGTTCAAAGGCCTTGAGAA
AGCGAAGCAGGAGGTACCGAGTGGGGTGGGACAGGTGGACCAGATCAGGAAGCTGGAGGA

gtgaggccaggggcctccagggttgagcaggcctgggactctggcagatctgaggcctct
tcttcccagagggccgcccggatccaagagaagctgctggaagactcactgacggagctc
agagctgcaggtatgggcctggcccgccctggccccacctgcccgtccgcagtgggggcc

Exon 12 +       7514       7574   0   Internal     61    89        Good
tactgtcctggtggatagcttccagacggcgctgttcaaaggccttgagaaagcgaagca
ggaggtaccgagtggggtgggacaggtggaccagatcaggaagctggaggagtgaggcca
ggggcctccagggttgagcaggcctgggactctggcagatctgaggcctcttcttcccag
AGGGCCGCCCGGATCCAAGAGAAGCTGCTGGAAGACTCACTGACGGAGCTCAGAGCTGCA
G
gtatgggcctggcccgccctggccccacctgcccgtccgcagtgggggccagtctctcca
tccccctaacctccttccacagtcacagaattccagactcagttttagagttttagaatt
tgagactcaggaggactttagtccagaggaccctagaacaatcctcccaaagccagttaa

Exon 13 +       8779       8887   1   Internal    109   100   Excellent
tcctcaagacaattggggcacttcttccagaagtggggtgggtgctagacgggcaaacaa
agggaactgcatcgtgctgcatgcccggagaagcaacctcctggagcagcctggccagaa
actccattagcccttatcttcctgacacatggggttcctctgcctcctctccaaatccag
GCCTTGACCTCACCCTTCTTTCTCTACATCCAGAGCCCAAAGAGGTGGCGAGTGAAGGCA
CCATGCTGAAGCGGCTCATCGAGAAAAAGTTTGGGACCATGACTGAGAA
gtgaggagacaggaagggagcgaggcctggggtctgagggtgaggcctgggggcctggct
ggagggctggagggaaagggacattgcctgcccctctagaaggggatggagcgctgaggc
ttgtggatgagcctgtgggtgcaacgaggagaccctgggtggcttctgcacatccagagg

Exon 14 +      10540      10654   2   Internal    115   100   Excellent
gacttgggctctttctcatatctggaaaaggagacctcctggaaatgcaggtctgcagtc
atataaattttgtggggaggaggcaggcaagaagagcctctgggtggttctggggtgcag
taggcccagccagcaggtcagcccagcccctgtctctgcgacccccccgcccacccgcag
GCAGCAGGAGCTCCTGTTCCATTACCTGCAGCTGGTGGCAAGCGTGGAGCAGGAGCAGCA
GAAGTTCCGCTCCCAGGCAGCCGTCATCGATGAGATTGTGGACACCACATTTGAG
gtgaaccaggcaggagcgggaaggggccggcgaggggaaccccaggggcttgtagccaga
aatggctccaagtaactcccatggggatcggggaaggcaaagtctggctcattcacccac
cagtgccccactcacccctgcaggctggagaagaggacttcaggaattgaccccaggagg

--------------------------------------------------------------------------------