--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (28098 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        897        988   1   Internal     92    83        Good
gagtggacgggactcctgcctcactagagttccgggagctgctggactatgtaaaaactc
ctgcagctcagtgcctgcccaaaaagctggaaatatgaactattgggttaattcttatca
ggaaatgaaaaagagttgttagattaaacttcttcagtcattgtcgttctttgtaatcag
AGAAAGAAAAACTGAGAGATCAGGAAGAGAAGAGACAGATGGATAGAAGAAGTTTGGGTG
GCCACAGGAAACAAGAAAAGAAACAAGCTGAG
gtgtcaacccacaggataatattttgtcattttcatttttttcccccaagtcagaaacta
aattccagtaattggatgccaatttgctgatgacaaggcacttcctgataatgagtctgg
aattctgagcagcagtttcacaatctgtaattacacgtttccgccctttgcaataaggaa

Exon  2 +       5023       5097   0    Initial     75    40        Poor
aataattattttttatttaggctgttttttgtttaaattggctttgatggaactctgttc
catgaggaatctcagataagactttttaagagccaatcccagccatgcatttgtaccctt
aaatacctatgagttgggtaaattcctctcctctcaaggtcccaagataacttggagctc
ATGAACCTGTTAGAAAGTGATATTCTTTACTTACTACAGATCAAGAACCTTGTACAAGGA
CTCTGTGTAGACAAG
gtatgaagccagattccccaaggggcttttattggctctgtaagtcaacttcgattcttt
aagggaagagtgccattccagtcaaagccttggtaaaataaccaatttctccaattgtgt
catgttacaaaagaaaacagatttttattgtgcttatggaattaaccatgctgccataaa

Exon  3 +       7388       7454   1   Internal     67    61    Marginal
cctgctgagctggcttgaaaagcaggcttataggggtcctaaacccatgttctatcttgt
gatacccctctttccattacagaacactgaaagacaaattcttagcaaaaatacaccaga
tttgctataggctaagactagtcttgtaaattcttttttctattaatcaaaactttacag
AGAAACATATAGTGATGTTTACTGTTTACACAGATGGAGAAAGAGAGAGAGACCAGAAAC
CTAGCTG
gtaagaatttcttacactttttgctggcataccagatttctgggtgccttttctctgtaa
cttccagaagaacggaacggcttctgatcagcctgctcacctcaccatagttgtggggtt
caagccactttacaagaaaaaagtcaccattttctgttttatggaaacataggcaagatt

Exon  4 +      14766      15020   1   Internal    255   100   Excellent
aaattgttaaacaacctggtaggaatatgatgaatgacagaactctataggtacaagaag
acagatggtgaagtaggacatactttcagaagtatttcacattatagaactatatctaaa
gtgagggtgaaactctttaagctgtgcccatagttaaaggaatctttctatttctaacag
AAGGCAACCACAGAAAAAAGCCACTTAAGGTGTTGGAATCCCTGGGCAAAGATTTCCTCA
CTGGTGTTTTGGATAACTTGGTGGAACAAAATGTACTGAACTGGAAGGAAGAGGAAAAAA
AGAAATATTACGATGCTAAAACTGAAGACAAAGTTCGGGTCATGGCAGACTCTATGCAAG
AGAAGCAACGTATGGCAGGACAAATGCTTCTTCAAACCTTTTTTAACATAGACCAAATAT
CCCCCAATAAAAAAG
gtaagactggattttttacaatgaatgtctcaattttccctaaatctgtttaactccaag
gcctaagcagtgtcttctgtgattcccctatctttcccttcctaaactatcattttcact
aaacctatctttgtccttttagagaccacttcccttttgtggggtggaatccagtttaca

Exon  5 +      15642      15710   1   Internal     69    58    Marginal
tcaagatattagctctcatccggaactctctcctctgaactccaggatcatttagctcta
gcaacatattcaacaggtctacttgagtgttttgctggcatcacaatacaaatacagcta
aaatatacactttgttccccagaacaaaactgttgcatttttattcccttttcatctcag
TAGACCGAAACAACATCTACCAAGTTTCTCCCACCAGAATGCAACTGGTTTCTTCACCAA
TTAATAACA
gtaatcagtagttttcttggcacatagcagatgcctaaataatgtaggatgagtaaataa
ataaagtatatgcattcaataaatactagttttcataattattatgtggatgctatgaac
tagacttttccagtgcttacttacttctgcgaattacaaaatatgataaggagaatctcc

Exon  6 +      18669      18842   0   Internal    174   100   Excellent
aatttcagatatgtccggttctttccctgggttcttgagagagagaaagtcagtgtcttt
tgatacaagttagagcagagaggagctgcatgaagacttgaaaaagcaacactgataggc
ataaggaggctgaaaggagacttgagtaaattaaatttattgcatctccatatcctgcag
ATCTATCCAATAAAGGAGAGAAACAACCGCACACGCCTGGCTCTCATCATATGCAATACA
GAGTTTGACCATCTGCCTCCGAGGAATGGAGCTGACTTTGACATCACAGGGATGAAGGAG
CTACTTGAGGGTCTGGACTATAGTGTAGATGTAGAAGAGAATCTGACAGCCAGG
gtaagaatccctcagccgccacaaacacatacatattcaagacacatccttctaataact
acctagcttcaaagagctcaacaaggtttaacaacctttgggtgtgtgtgtgtgtgtgtg
tgtgtgtatacaaaataagagtactagactggtaaatctatgtctctttggtcctccaaa

Exon  7 +      19449      19559   0    Initial    111    82        Good
taggttacagtagagagaaacagtgaaattgtaagaaaaaagacaacttcaagcaccagg
tgtgcatatgtgtgtctacaaaacagcgacaagacagccaaaagtaagtaaaaagaaaat
aaaaaggaaatatgagacagaattgtagggtggggagcaacgtttttgggttggttggag
ATGGCTCTGGAAAGACATGAATGCAGCGCCTTCAAAGTAGGAGACGCCACCTGTGAAAGA
GCTGAGCTGAAAATGAACCTGGCACACGAGAAGCACAAAGAGAAGACCAGT
gtgactagaggttgaaggagaaggaacatagtatgagggtggtgtatggtcaggccagaa
gtttgattctattctaagcatagtgggatggattttacaaagaacatggtgtgttgcatt
tataacacatgacttgctaggtaaggagatagaagattgagatggaaaagaaaaagtaac

Exon  8 +      19990      20196   0   Internal    207   100   Excellent
cacggccccataaagaaggaaaaataaaaccattaaacagctgtcatgactgagtaagca
ctaagtgaagcaccacgacctggatgttacatatgtttcttgtttcgctcatggtaaatc
taggagtcccctttaattgtgatgcttctctgactgaagttagacattgctcttttacag
GATATGGAGTCAGCGCTGAGGGCATTTGCTACCAGACCAGAGCACAAGTCCTCTGACAGC
ACATTCTTGGTACTCATGTCTCATGGCATCCTGGAGGGAATCTGCGGAACTGTGCATGAT
GAGAAAAAACCAGATGTGCTGCTTTATGACACCATCTTCCAGATATTCAACAACCGCAAC
TGCCTCAGTCTGAAGGACAAACCCAAG
gtcatcattgtccaggcctgcagaggtggtgagtgctgagactgaacatctaacagttat
gaaggtgtatgcagaggattgtgatgtttggtttatatttaggggcaacattcttaaacc
tcatccagtgtaaataaagtacattgaattctaaagaaactctacctaagggtctggtat

Exon  9 +      21153      21254   0   Internal    102    79        Good
tgtgggtctgtatgtatgaaactagtaagaatgaacattcaaaaagaacaaggtgggcaa
ctgtgacagccattctgtgggaggcacagcagtgtgcagaaagttaatgtctccatagca
aaccgtggggaactgtgggtcagagactctccagcatccttggaagtggcctcttcacag
TCATCTGAGAACCTAGAGGAAGATGCTGTTTACAAGACCCACGTGGAGAAGGACTTCATT
GCTTTCTGCTCTTCAACGCCACGTATGTATCTTTCAGTGGCA
gtaagggatttgtgggcctgaggccatctttgaatgaatctagaaaatcaagaatcccta
tgaaacaatgatctgatagaatgttgtgtgctctccacatattttacatgatcttatgtg
tgccgtgagaacagattcctaaagcaacccgatacatggaaacccattcaccactcacca

Exon 10 +      22517      22684   0    Initial    168    95   Excellent
ttcaatacacaatctcttgcaatgcttaccaactgcaacttttgatcaccttttgctagg
ttttctgtttacgttctgtggaaagtaggtaaatgtcaggttgtaagtgcttcctacaaa
tctgtaaagataattcccaagctatgcttttctttttaaaaacattctcaaaacaaaaat
ATGAACAAAAACATAGTGAAAGTCATAGCCCAAGGCATACCCATCTGTATCATTATAGAC
AACGTGTCCTGGAGAGACAGCACAATGGGCTCTATCTTCATCACACAACTCATCACATGC
TTCCAGAAATATTCTTGGTGCTGCCACCTAGAGGAAGTATTTCGGAAG
gtaagtgtctcttttctagttactcatttatttcttcaggaagaatttgtcatgattcac
tttttacttcacaatgacaatttttgtcagggaagtgaaagtagagaggtacccagtttc
tgtcattcagttgtttaaaatatggctaaggaaaagacaattccaatatatcccagcaga

--------------------------------------------------------------------------------