--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (59589 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (18 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5650       5740   0    Initial     91    66    Marginal
agcccctggtagccagagttcagggatgtttggaagaagggcatccctggcacagccgca
tgggtggtccccaatgtctggaccctgcctgcctttgacagcgtgctgggcctttcaggg
tggagtgcagctcatttcagacattcacgcaataagcccagtgctttgcagggtcatttg
ATGCTCACCATCACCCTACAAGGGGGTGGGGCTGGGGAGTCCCGCTTTACAGGTGAGAAT
ACCAAGGCCTATTACGGCCAAGTCCTGTCTG
gtatgtggggtcaggtgaacaggctgggccagtagagcagaaaatacctttattttacag
atgagaattctgaagcacaaagaggttaactgctttgcacctcgctggcctcagtctccc
catctgaggacgggtatgtggacaggatgttgcccagcctgacatcttggggctctggtt

Exon  2 +       7244       7328   0    Initial     85    67    Marginal
ctccctgccactcaatcacgagagcctgtggccagagagggcaggagctttcctgggctc
acacagcacagtgaggcagaggtggcttcagtgacctgatcaagtcccattttgttaggt
tgtctctccggtggggagtgagcgagcacacagcccccaccccaccccgggtgagagaga
ATGTCCTGCACAGGGACGCCCAGCTGTATCTACCTGCTGTCAGCACTTTCTCTGCAGGAC
CTGGTGCTGGACTGGGAGCCCCGAG
gtagggtggccaccgcactgggttgcctgggactgtgggtttcctggatgtggttctttc
agtgttaaaactgtggtgagctgctcacccgaggcttggcctggggctgccccctgccca
acagtctccacctccacaagtgtggccaggtccttgacttcttcctgtcctgcccaaggc

Exon  3 +      19070      19242   1   Internal    173    87        Good
ctctgctgtataccagctgtgtgaccttgggtaggctccacgcctcgctgagccttccgt
gcctgtgccatggggctgatgatgtccgcttcacagggcacatcagggacccagggactc
tgtgagtgaccgtcttcttgccttcctgtccaggtgttccccctcccctccctggggcag
CAGCCACCATGTTCTCGTGTGTGAAGCCCTATGAGGACCAGAACTACTCAGCCCTGAGGC
GGGACTGCCGGCGCAGGAAGGTGCTCTTCGAGGACCCCCTCTTCCCCGCCACTGACGACT
CACTCTACTATAAGGGCACGCCGGGGCCCGCCGTCAGGTGGAAGCGACCCAAG
gtcagtgtctggtcccagctggagctgggtgagcgggcccaggcccacccacaaggctgg
gcctgcagggacatcggggtggtgggaggaggcatccctggccccaggctgctgagaaag
tgagggtgctgaaacggtgggatttgatccggatggggagcttggagaatgggctgtaat

Exon  4 +      27873      27994   0   Internal    122    97   Excellent
agcggggagcagatgggccctatggggccccaagtctgtggtgggaggcaggtgaatcac
catgctgatgatcacacagcaagtctgtgtctgtcacgtctgtgtctgtcatgtctcctg
ccatggggggcatccgcatgctcctccgcccctcacgctctctcctcgccttctccgcag
GGCATCTGCGAGGACCCCCGCCTCTTTGTGGATGGCATCAGCTCCCACGACCTGCACCAG
GGCCAGGTGGGCAACTGCTGGTTTGTGGCAGCCTGCTCGTCACTTGCCTCCCGGGAGTCG
CT
gtggcaaaaggtgaggcctcgggcagagtgggcagggtgctggggagtgtgaacgcagcc
tgtggccctcactgccagacaggcggaacctgattgtggcagatgagactttcaaaagcc
tgtgccagggatggggtgggggcccccagtactggccgagcgtcggaattgccatccctc

Exon  5 +      36982      37504   2   Internal    523    94   Excellent
tgcattatcgcttctgcggggactggagtggaggcagatggggactcccacccctgacac
acaccccattttgagaactgagtggggctgggaagagccagtggcaaagggaggggaaga
gggaagggcagaaagtaggtggggcccccctttggtggcctcttctctccacggccccag
GCTCCAGCCCACTTGGGTCCTTGGCGTTGGTGGCAGCAGCACTTGGGCCATGGCGGAGGA
CAGGCCGCAGCAGCCGCAGCTGGACATGCCGCTGGTCCTGGACCAGGGCCTGACCAGGCA
GATGCGGCTACGCGTGGAGAGCCTGAAGCAGCGCGGGGAGAAGCGCCAGGATGGGGAGAA
GCTGCTGCAGCCAGCGGAGTCTGTGTACCGCCTCAACTTCACCCAGCAGCAGCGGCTACA
GTTCGAGCGCTGGAATGTCGTGCTGGACAAGCCGGGCAAGGTCACCATCACAGGCACCTC
GCAGAACTGGACGCCTGACCTCACCAACCTCATGACACGCCAGCTGCTGGACCCCACTGC
CATCTTCTGGCGCAAGGAGGACTCGGATGCCATAGATTGGAATGAGGCCGACGCCCTGGA
GTTTGGGGAGCGCCTGTCGGACCTGGCCAAGATCCGCAAGGTCATGTACTTCCTCGTCAC
CTTTGGCGAGGGTGTGGAGCCCGCCAACCTCAAGGCCTCCGTG
gtttttaaccagctctgacagcagctgccagctgctgctctcctctagcccacctgtgct
ctcccctgcccctgccactttcccccctgtatttttggggccattattctcgctgctcag
cctgtcctctgcttgcccagaggccccctgagtcccacacctttcctcctctgcttctcc

Exon  6 +      40015      40129   0   Internal    115    64    Marginal
aggcagctcccaaccccctcccagactcaggccttccagagtgaacagcttggttctgtg
aaggtccttccagccccaccctccaggaattgtcaaacctgtgctgggctagactgacat
gggcaagatgtagccccaaggccacgtgacttcagtgcctcacttgatccttcctcacag
CTCTGTTCCCTCATCACCACTCTGAAGCGCACTCATTTTTGGACAGGGACAACTGAGGCC
CAGAGGAGGCGGCCTCCTGCCCAGGTCACAGAGGGCGTGGAGGGGCTGGAAGCAG
gtgtgggtgggccaggctcttggcctgtggacctttggccccatgacactggtccctggg
atggaccggggagatgggccccacccacctgagaacccaggctcgggttgggctggcttc
tttcctggagaccaagtcaagccctgccttgggggtctcaccagtggttttgttttggaa

Exon  7 +      44939      44972   0   Internal     34    74        Good
tgggcagccttctgccagcaccttccggtagtattgcctcaaaagcctgtcctgaggctc
aggggtgctagtgtgagcagcctggccctgtgcctggcacccaacagggctccattaggg
cagtagtacctctcgctgcagttagcattttcattttcttggtctcacatgtcccattag
GGAGCATTTCCCTTTGCCAACATCCCTTTTGATG
gtaagagttttgtttgttgatgcaaacaaaagtgtccttaatgagcatgcagtggggagc
agcttttggctgaagtctgtacactcaggtgagtgccggcctcctggtgtgcctctggtt
cctccgcctgggtgccccccatacctggagtggttttcttctagaaagagctgcttatgg

Exon  8 +      45252      45317   0   Terminal     66    47    Marginal
cctcctggtgtgcctctggttcctccgcctgggtgccccccatacctggagtggttttct
tctagaaagagctgcttatggtcctgatggggctcagctccacttggtcccgtgcccagc
agggccaggggtcattcaccctgacttgacagggtgaggggttttcccttctctgcccag
ATTGTGGCTATTGTCCTCATCTGCTTGGGGGACGCCTGTAGCAGCACTGCGGATGCTGCT
GAGTAG
ggtctggcactcccttctggtatagccccgcctgcaccctgtgtagcctcagcactttgc
ctgggtgcctcctcctctccccagactgggagccttttgagggaagggaccatgtgattc
acctggttgtcagtgtccagcttggggctggttgcagagtggtccacagtgccaaggagc

Exon  9 +      46790      46988   1   Internal    199   100   Excellent
gagatggggaggattcatccgggtctcacgaaggcttgtggcagagttggaatccgaacc
cagtattcctttacattccgattcgctggaagcacacgcccccatttcctcaggaagccg
gacatcccctcactgtgttcccccatcctatcccccctccccctacccaggtcatcccag
ACTGGAAGGAGCAGGAATGGGACCCCGAAAAGCCCAACGCCTACGCGGGCATCTTCCACT
TCCACTTCTGGCGCTTCGGGGAATGGGTGGACGTGGTCATCGATGACCGGCTGCCCACAG
TCAACAACCAGCTCATCTACTGCCACTCCAACTCCCGCAATGAGTTTTGGTGCGCCCTAG
TGGAGAAGGCCTATGCCAA
gtaggtgccagcagcaggcaggtgggtgggaggcccagacgggggtggcaccggatgggc
tcctcgtggtattccgttagccagggctttaggcacagagaagtgaggggctggtgcagg
cacgcagcaggctcaaccgccaggcctgagggcatagtcagctgagcctgtgctgggtgg

Exon 10 +      48433      48625   2   Internal    193   100   Excellent
gccttatatgttggcccgagtgttaagaactgggttccagtgttggctccgccgtggcct
gctgcgtgactgtaacaggttgtttgacccctctgagtttcaaaaacctcccctatgagg
taaaggatgcagcctggctggggagcatgagctgggaagtctttccacattgcttcccag
ACTGGCAGGCTGTTACCAGGCCCTGGATGGAGGCAACACAGCAGACGCACTGGTGGACTT
CACGGGTGGTGTTTCTGAGCCCATCGACCTGACCGAGGGTGACTTTGCCAACGATGAGAC
TAAGAGGAACCAGCTCTTTGAGCGCATGTTAAAGGTGCACAGCCGGGGCGGCCTCATCAG
TGCCTCCATCAAG
gtgagaacacggcagtccccagaggcgacccctccccttcaccctcgctgactgagatgg
gagacaactgtgacatcccacgctcaggtcagctcctacgtattcagaccctcagcctcg
tgggggaggggagaagttggaaggtgcaaccccctgcccagaccctctaggctgtgaaaa

Exon 11 +      49586      49779   0   Internal    194   100   Excellent
ctttactgagactgctgcccatgggggttttaaagctctgtgaacacagcactgccccat
gactgcaattcccatcccatcctgtaggtcccgtgcagcctcctagccctccagcacctg
agtccctggtctgggttccagtgtggccctgcctctctgagcaactgtgtccctccacag
GCAGTGACAGCAGCTGACATGGAGGCCCGCCTGGCGTGCGGCCTGGTAAAGGGCCACGCA
TACGCCGTCACTGATGTGCGCAAGGTGCGCCTGGGCCACGGCCTACTGGCCTTCTTCAAG
TCAGAGAAGTTGGACATGATCCGCCTGCGCAACCCCTGGGGCGAGCGGGAGTGGAACGGG
CCCTGGAGTGACAC
gtgaggcctggggatgggggtgcaggcacagggcatgagggcttggacaaggacgggtgg
gcttcttggaggagttggcactggggctgggccttgaaggatctgggggaggatgacact
aggaacgaagaagggagaattactttgcagtggttgtatggggtgatggattgagcacaa

Exon 12 +      50417      50494   2   Internal     78   100   Excellent
ggagacaggcagggcttcctggagaggggctgggcatggcctcagtgcccctggccacac
cgtgccgctggaggcctggtgcaagactgcccctcgtgcctcctcgcctttgccagacag
attctggtggggctgcctcttagacagctccctttctcctccccggccctgacaccccag
CTCGGAGGAGTGGCAGAAAGTGAGCAAGAGTGAGCGGGAGAAGATGGGTGTGACCGTGCA
GGACGACGGTGAGTTCTG
gtgagtgtgtatgtgccctgggcgtccggggctgagggggcttcccacgggcctggcggg
gagcaccaggtggggagtcaggagccaggcctctcctgcatgccccatcatcaatttgct
gtgtggccttggacaagtcacaccatctcagagcctgtttcctcctctgtaaaattagtt

Exon 13 +      52348      52543   2   Internal    196   100   Excellent
gaggttaagggtctgtgcaatgccatgcctgtgcccttgtgtgggcttagctcccctctc
aaagccagctgtgttctctcacctctgggccatatggacatattaggttgttgggctggg
gggccaagagcctggggaggtgtgggggaggtaccctgctcagcccctccccacatccag
GATGACCTTCGAGGACGTGTGCCGGTACTTCACGGACATCATCAAGTGCCGCGTGATCAA
CACATCCCACCTGAGCATCCACAAGACGTGGGAGGAGGCCCGGCTGCATGGCGCCTGGAC
GCTGCATGAGGACCCGCGACAGAACCGCGGTGGCGGCTGCATCAACCACAAGGACACCTT
CTTCCAGAACCCACAG
gtgggcgttctcaggaacccccaccctgccctgtagcagctgcggggtgccttgccactg
tcctgccagggactcctgcatgaccttgggtaatccctgtccttccttgggcctcagcaa
acctgtctgtacagtgggggttagatgggcacatccgtcccatctgggggtcatgaagcc

Exon 14 +      53221      53394   0   Internal    174   100   Excellent
ccttcatgcagggtagccattgcaggcattggtaggcccacctcacagcagagggaccaa
ggcgcagagaggtgctgtgactggtccaggctctggagtctgagcttccgggagccagcc
agcccatgcctggtgtggtctcattgcagtgtctctctctctccttggccacacctgcag
TACATCTTCGAAGTCAAGAAGCCAGAAGATGAAGTCCTGATCTGCATCCAGCAGCGGCCA
AAGCGGTCTACGCGCCGGGAGGGCAAGGGTGAGAACCTGGCCATTGGCTTTGACATCTAC
AAGGTGAGGCCAGCCGGGTCCCCTGCCGTGGGTGGGGAGAGGGAGGGAGCTGGA
gtttggactgcccatgcctgaggaagaacgctctagaacaccttggtcactgccgctgcc
ctggctgccgtggcagacattgtgaggatgccgtggcatgggccccacttgaatattcac
agagggcccagcctgcccagccttggcttctgtgggagctctcagcctgatttctttctg

Exon 15 +      54885      55100   2   Internal    216   100   Excellent
accacccattcccattgacctcttcccttcagccctgggcaaacacgaatccgcttctgt
tattatagatttgcctgttccggacatttcatataaagggattccatcgtcccttccatg
gtggtgagggggaggcggggtgggccagggtgttgtagggtgtgtctccgcgtggcccag
CCCCTCCCGCCTCCTGCAGGTGGAGGAGAACCGCCAGTACCGCATGCACAGCCTGCAGCA
CAAGGCCGCCAGCTCCATCTACATCAACTCACGCAGCGTCTTCCTGCGCACCGACCAGCC
CGAGGGCCGCTATGTCATCATCCCCACAACCTTCGAGCCAGGCCACACTGGCGAGTTCCT
GCTCCGAGTCTTCACTGATGTGCCCTCCAACTGCCG
gtacttgggggctggcttgaggccagtgtgggtgggagtgacattcacactgggccaacc
aggaacctgcagcctcagagatgctcagtgtctctgggcctccagccactctgggctgat
accagtgcccatctccttcccttctcttcccttgttcccctgtcccagcatccctggcca

Exon 16 +      56125      56240   2   Internal    116   100   Excellent
gcaggaagcccacagggcttggagctggggactgcccatggggatttgctcaggactaaa
tgaaatcaagtttgggctaaatactgcttctcttcccttcccacttcctgaaccccctct
tcacccctgtcttcctggcccttctccatcactcccctctcccctgccgccccatatcag
GGAGCTGCGCCTGGATGAGCCCCCACACACCTGCTGGAGCTCCCTCTGTGGCTACCCCCA
GCTGGTGACCCAGGTACATGTCCTGGGAGCTGCTGGCCTCAAGGACTCCCCAACAG
gtgagctctcccagggagagtcccccggccctcctgccagttgtcccatggcctctctcc
accagcacggataccagcctcagagctctcctgctctcagaggcactgcaggcctggcca
tttctggggtgatgcctgatgctgggcacatagagaggaaaaggtttaccttctgctctc

Exon 17 +      56767      56903   1   Internal    137   100   Excellent
tggccagtgtgcccctgctggccggcctgtctctggaaacgaaggggccctgaggtgggt
caggctccagtctctccatctgaataactgagccgggtgggcatctcacctgtagatatc
tgtggccctgccacagcccccacccccaccctcaccccatctcccactccctctccctag
GGGCTAACTCTTATGTGATCATCAAGTGTGAGGGAGACAAAGTCCGCTCGGCTGTGCAGA
AGGGCACCTCCACACCAGAGTACAATGTGAAAGGCATCTTCTACCGCAAGAAGCTGAGCC
AGCCCATCACTGTACAG
gtgagccccctggtccagaggccacctcctgggctcctagcctgaggcttccccactcag
ggggacaagcccaggtggaagaccctctgacgaggacccaggcatgctgggctctagctg
tctgtctatccctgacccctggtgtggctttgggagctctcttgccactccaaggtccct

Exon 18 +      57879      58061   0   Terminal    183    92   Excellent
ggctctggaaggggcaccaccttgcccgtagttcatggggaggcagacagcccagggccc
ccgatcctcagccaggcttgcacttcaaggccctgccaccaccaccagcaccccccatag
acctatattgctggtcttggaggtagcccgcccctcccatgatcctctgtctcttcccag
GTCTGGAACCACCGAGTGCTGAAGGATGAATTTCTGGGCCAGGTGCACCTAAAGGCTGAC
CCGGACAACCTCCAGGCCCTGCATACCCTCCACCTCCGGGACCGAAATAGCCGGCAGCCC
AGCAACCTGCCAGGCACTGTGGCCGTGCACATTCTCAGCAGCACCTCCCTCATGGCTGTC
TGA
cacctgcccacctacctggctctgaccgttcccaccaccatctgcatgtccccactgggc
ctgagtctagcctgggagccaggatactggggtccttttcccactcttccactgacttgc
tgtgtgaccttaggaagtctctgcccctctctcagcctcagtgtcccgagggccccgaag

--------------------------------------------------------------------------------