--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (47958 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1305       1780   0    Initial    476    62    Marginal
agagaaagaagagggggagagagagagaggccggcgtggaggggaggagggagagcgagc
aggccgggcaaggagtgcacagccacagcctcctcgcctccccaaactcccagccaaggc
gcgcggtggcgtcctcgcgccctcgctcgcgtccccgcccgccgcctgcgcaagccaggc
ATGAATGCTGAGACTTGCGTCTCTTACTGCGAGTCGCCGGCCGCTGCCATGGACGCCTAC
TACAGCCCGGTGTCGCAGAGTCGGGAGGGCTCGTCGCCTTTTAGGGCATTTCCCGGAGGC
GACAAGTTCGGCACAACTTTCCTGTCGGCCGCCGCCAAAGCACAGGGATTCGGGGACGCC
AAGAGCCGGGCCCGTTACGGCGCTGGGCAGCAGGACCTGGCGACACCCCTGGAGAGTGGA
GCTGGGGCGCGGGGCTCCTTTAACAAGTTCCAGCCCCAGCCGTCGACCCCGCAGCCCCAG
CCGCCGCCGCAGCCGCAGCCGCAGCAGCAGCAGCCGCAGCCCCAGCCGCCCGCGCAACCG
CATCTTTACTTGCAGCGAGGCGCCTGCAAGACGCCCCCGGACGGCAGCCTCAAACTCCAG
GAAGGCAGCAGCGGCCACAGCGCGGCCTTGCAGGTTCCCTGCTACGGTGAGTGCAC
gtgcgggtcacctggtgctggggaccacggggtgcttggcttccgcatcccttgaaactg
gtggcttgcgggaggtatgagttggcgggctgggggcggggtggtgactctggtcggtaa
acgggatcgatcgctgcgagggagccaagggatctgttctgtctccttcttgtccgccgg

Exon  2 +       7024       7222   2   Terminal    199    52    Marginal
agaggccttgggatgattcatggggggggcgcgccctgccttggtgagcctctcgccccg
agggtaggcgaggtgggtgggtaggggagtgtatgccggagagaagagagaacgcttaac
cagagagaacttcctgcccccggagcctcagcgtccttagccccccaaacccctgttcag
GAAGCCGAAGGACCTAGGCCCAGGCAACGGTTTGGGGTGGGGCGGTAAGAGCGCCGTCCT
GCACCCGGACGTCGCCTGCCAGGCGCCACCTGGCCATGTGCGCCCGCAGCGCAGGGTTCT
CCGGCCATCAGCACAGGTCCTCACCGAGGTGACAGTCATCGGATTGGGAAACCAACACTG
CGAGGACCCGGCTATGTGA
tgataccgtccgggggaattcgagtggaagccgaccgtcctgtggtgccactagacaggt
gagaagcagcccttccaaacagggccctttgctggaaggaggaggcacctctttccagcc
agtgagccttcccagctgcaaccggggtcttctctaatatcagttaccgcggcctccaga

Exon  3 +       8140       8297   2   Internal    158    66    Marginal
gctgccaagtacctatctttcccggtgaaggcgccgcttgtactcgggaccgcttggtca
aggctgctgggcactggcgccgctgcacattgggggcagagagggagccagtgcttgctt
catcggattcttaaagcagattctttaagagtggattttcattctgaactggaggcccag
CATGGATGTTGGCCCCACGCACCTCGTAGAGGGACAGGACCTGGTGACCCAGGTCAGAGC
AGAACAACTGGCTCTCCAGGGCTCTGAAGGCCACAACAGAGAAGGCTGGGAAGCTGTGGG
AGGTTTGGACCATGACACTGATGTCCAGCGCGGCACAC
gtggggaccggggcccacagttgcggtgtagatcaccccagcctccacctttgcattctc
tactcctccatggccttggagaagtatgttctgctccggggtctgaattttagctgtatg
aaatgcaggagtgttgacaatttccaaagaccctcttggagtttctgtgctggtagcagt

Exon  4 +      15343      15450   0   Terminal    108   100   Excellent
atcgaccggtcttgggacctttgttgaaaatcaattgcgcatgtatttgagagtttacat
ctggtctctattctgttgcatttgtctatctggcccctgaatgatcttctgatgtgaagt
ccaggattgcagaatgtacaaggacccttgtaggccatccgttcatctccttgcctgcag
GCCAGTGACCAACAGGTCACAGAAATTCAGCTCAAGGACACATTTGTTTTCCGGGACCTG
GAGCTGGTGAGAAGGGGTGGAGGGCAGAGCCAAAGGCGAGGACTCTAG
agccacagtcttggccctggctaggcccctggatattcgggggcccctctgccccttcag
ttgaccatcccatgaggacgtggcctttggggaaattcttttgtgctctgagggtctata
cacccacctcctgagatgcgcacatctgggaccacttcctttattaagatgattccagaa

Exon  5 +      20288      20354   0    Initial     67    48    Marginal
gtgaatccactctttaaaagtttttttaagtctatataaccaaataaatttaacatttga
tttttacagcagttgccaatgtttcaccccatttatagtctttgttatatgtatgtgaaa
tgggcccttcattgaaagggaccctgggagctacttttgacagaggtttatggttcataa
ATGTCATTCTGGGAGCTGCCGCTCGGGAAACCTGAACTGGAGAGGATGCACCTGGGGAAG
GAAGCAG
gtgggggtgacacagttgcaggctgagcaacgttgccctggctgtcagctgccacggcca
aattcatccccagatcataactgtgttaatatatcatggcaacgtcccattgatagagtg
ggtgccgtgtgtgggtcaggggatatgccgtcttgcactctacttcagtcagacctcaca

Exon  6 +      30731      30990   1   Terminal    260    48    Marginal
ttcccacttcatcaaaagcagtctatggcaataatgctgacctaggattgtttgaagagc
actggataccatgatggccacactgcgtgcacaacaccctccgtggagcaggcattgctc
tcagtgatgtaggttcactacttgattgatggctctaagtagtcaggggtttacttccag
ATCAAGACTGGGAAGCTGCAGATTGGGACTACATTGTCTTGGACCCCATAGCCTCAGCCC
TGGGACAAACTCATCATGGGAGGGGCATCAGCATAGAGCCTTTCCGGGTCCACAAGGAGC
TGCTCCAGGGAGGATGTGAGAAGTCCAACCCCTGGCGGGTGGCCTGGACCCACGCTGGGC
GCTGTTGCTGCTCAGCCTTATGCCAGCACGAGGTGCCCCAAGGCTCTGAAGAAGGCTTGC
CCAGCATCCAGGCAAACTGA
gagctccctggcggtcttctctaccccagtgtggtggcagggtgggtgtggagccagttc
ctggcagatcctggactgggtttctggaccttggtttcaattctggagccgcccctatga
agcccgtctctgcttctccttctgtcccttgctctctgcatggagacatcgctcaaggtc

Exon  7 +      35765      36023   0    Initial    259    94   Excellent
ccaatgagctctaagaggaaaaaggcagggggtggctacccgagtgccccactctccccc
tgacattccccttctcttgtttggttcaaccattggtttctgactttgtttcctcctccc
tcagctaaagagagctccctgggtgagccagagttaccccctgactctgacactgtgggg
ATGGACAGCAGCTACCTGAGTGTCAAGGAGGCTGGGGTGAAGGGGCCCCAGGACCGGGCC
AGCTCAGACCTCCCCAGCCCATTGGAGAAGGCCGACTCAGAGAGCAACAAGGGCAAGAAG
CGGCGGAACCGGACCACCTTCACCAGCTACCAGCTGGAGGAGCTGGAGAAGGTCTTCCAG
AAGACCCACTACCCAGACGTGTATGCGCGGGAACAGCTGGCCATGAGGACAGACCTCACT
GAGGCCCGCGTGCAGGTCA
gtgagggccacctgggagtgaggctggtaaagcagagcctgtccctgggctcttggctgc
agttggggtctcctgactgcccaccaaccacaccatggctttcctttcctcagttcattg
agaacctgaaagtgggggctcctagcctgcccctcatgcccctgtcccaactagagcgac

Exon  8 +      38183      38325   1   Terminal    143    73        Good
tttaagtttcaatttaacacaaaataaatgtcataatcagtccgcttttccaacccaaag
catgttggaaatagcaaataaaacgttgccacatagcagtttttccctctccagtgggcc
agaaaaatcaatagcttcagaacaaagagaaatcttttttttttttttttttttaatcag
CAAAGCGCCATGCAGCTCAGTGGGCTGAGCCCTTCAATGTTAGGACAGAGATGCCCCAAC
CCTGCAATCCTCAGCAGGCCCCAGGGACTCTTGAATTAACTCATGAAAGCATCTTCAGCA
GCATTGTTCTAAGGCATCAGTAA
aagattcatcagttacaaccattttctgtttaagaaggcagaggcatctctaatagagtc
tacaaactttttttccaaaatggctaatgtggaaaaggactagtggttatcagtaaatat
gtagctgttcagaaactgcagctaccagaagtgatgctgaagagctgcacggttgagttg

Exon  9 +      41951      42012   2   Internal     62    74        Good
gaagaggcttctcctcccccagtcaatgtgtgtgcacacatgcacgtgcgtgtagccaca
ctagtgggtacactcgtgcacgcacacacatgcttaggattagggaggggaaagtgagtt
ggtacaggagtggagaaacataataatgtacacccctgctcacccccaccctcctcacag
TAACATGAGATACATCCCCATCTTCCTTGACCTCTTTCCTCTAGCAAAAGACAGTGAGAA
AG
gtcaggagctgtaaagaaacaaatgggaagtactctaaacattcttggactgcatttccc
atctatctcccctgctgcgactatgaggtaccattcgccatgcagaaactgaggcccttg
gcaataccagtgctcctatgagcctgtccattggccagctacactggatgcccaaagagg

Exon 10 +      43745      43873   0   Internal    129   100   Excellent
gattctagattgtcagctcttgaggacaaagaccaaggttgatatttatgtgtggccgca
ccgtttcccaaacgcactgcaactgatggggggctcaagggaacagtttgcactgcctga
aagtgaggcctccaggcgggcatctcaccctggtgacaatggctttttcgcgtcttgtag
GTCTGGTTCCAGAACCGAAGGGCCAAGTGGAGGAAGCGGGAGCGTTTTGGGCAGATGCAG
CAGGTTCGAACCCACTTCTCCACTGCATATGAGCTGCCCCTCCTCACCCGAGCTGAGAAC
TACGCCCAG
gtaagtcccgccctgagctgccgccaccgatccccagcccctggtgctctgagaatgagc
cccttggaggagagcccaggcaccccgagatgacttatggctccaggctgcccttccgtc
tcattccaggggtgtgcctgtttataccagagtgtgggaggcccagggttaatctatcca

Exon 11 +      46184      46513   0   Terminal    330    85        Good
tgccaaggtgtaaaagccacccccacaggggtatctggatgtccatcaaggctaaacact
caagaggggcttcatgggaaggatggacagtgaggggagaggtgctctgggggaaggggc
gagccccttccacaccacacctgcccgccagccggtgacatctctcccttcctctcccag
ATTCAGAACCCGTCCTGGCTCGGCAACAACGGGGCTGCCTCACCAGTGCCAGCCTGCGTG
GTCCCCTGCGACCCGGTGCCTGCCTGCATGTCCCCTCATGCCCACCCCCCTGGCTCTGGG
GCCAGCAGCGTCACCGACTTCCTGAGTGTGTCTGGGGCTGGCAGTCACGTGGGCCAGACG
CACATGGGCAGCCTGTTTGGAGCAGCCAGCCTCAGCCCAGGCCTCAATGGCTACGAGCTC
AACGGCGAGCCGGACCGCAAGACCTCGAGCATCGCGGCCCTCCGCATGAAGGCCAAGGAG
CACAGTGCGGCCATTTCCTGGGCCACATGA
cagggcacccctgccccgtccccacctcgggacaccatgggccacgcccatgttttccag
gcccccagcctcccactcgactttcctcttaggaacctggcctgggccaggggcctgacc
ctcagcactttcagccgccccaagtctgaggccccgtggactgctgggagggagggggca

--------------------------------------------------------------------------------