--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (86416 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (46 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        966       1474   2   Internal    509    71        Good
aacgttctgccccacttttctcatccatgttgggtggagacttgcgccatccctcggctc
tctacatccatccgcaccacgcccaggtgaactcacactcgggaccctgaacccgcccac
tccaggccttgcgggcccttctctcctcttctgcacgccccaccctcctttcccacccag
ACTCCAGTGTGCCCACACCCCACTCCCCATCTTAGCCTGCCTTTCCCCTCTCCCCCAGCG
CACGCGTGCATCAGGGCACTCACGAAGCCACCCCGGCAACATCTGGGAGCACGCGCCTCC
ACATCTGGAAGGTGGGCGCAAGCGTAGCAGGGCCGGTCGGGTTCCTCGCCGCCCCCCGGC
CCCGCAGGTGGTGGAGCAGGGCGGGGTGAGGGAGGGGGAGGCCAGCGGGGCTGGGCGGGG
CCCGGGGGGCGGGGGCCTGACGGCCGGGCCGGGCGGCGGAGCTGCAAGGGACAGAGGCGC
GGCAGGCGCGCGGAGCCAGCGGAGCCAGCTGAGCCCGAGCCCAGCCCGCGCCCGCGCCGC
CATGCCCCTGGCCTTCTGCGGCAGCGAGAACCACTCGGCCGCCTACCGGGTGGACCAGGG
GGTCCTCAACAACGGCTGCTTTGTGGACGCGCTCAACGTGGTGCCGCACGTCTTCCTACT
CTTCATCACCTTCCCCATCCTCTTCATTG
gtgagtgcgcgcagcgagccgcggaggaggggacgggagagcagggagggaggaggaggc
gctgcgcgccgcaccgctcggcgtccccttccggcccgcgaccgccgtccgcctcgttcc
cggggtcccctgccctgtgtcctgcccgccggtccccgcactcgcacaccagctcatccc

Exon  2 +       1327       1474   0    Initial    148    93   Excellent
ccgcaggtggtggagcagggcggggtgagggagggggaggccagcggggctgggcggggc
ccggggggcgggggcctgacggccgggccgggcggcggagctgcaagggacagaggcgcg
gcaggcgcgcggagccagcggagccagctgagcccgagcccagcccgcgcccgcgccgcc
ATGCCCCTGGCCTTCTGCGGCAGCGAGAACCACTCGGCCGCCTACCGGGTGGACCAGGGG
GTCCTCAACAACGGCTGCTTTGTGGACGCGCTCAACGTGGTGCCGCACGTCTTCCTACTC
TTCATCACCTTCCCCATCCTCTTCATTG
gtgagtgcgcgcagcgagccgcggaggaggggacgggagagcagggagggaggaggaggc
gctgcgcgccgcaccgctcggcgtccccttccggcccgcgaccgccgtccgcctcgttcc
cggggtcccctgccctgtgtcctgcccgccggtccccgcactcgcacaccagctcatccc

Exon  3 +       3076       3217   1   Internal    142   100   Excellent
agcataggaccaggctgaatgagttggacgtttagtttgtgtgtaccagccttggggatc
ctcatgtgtaggtgtcaccctcaccatggacccaatgcccaagcacctttctggggttca
tgcaccctcttcctcctccaagtgggcaggcatcctgcctctgactgtctctccctgcag
GATGGGGAAGTCAGAGCTCCAAGGTGCACATCCACCACAGCACATGGCTTCATTTCCCTG
GGCACAACCTGCGGTGGATCCTGACCTTCATGCTGCTCTTCGTCCTGGTGTGTGAGATTG
CAGAGGGCATCCTGTCTGATGG
gtgagtgactgtctgaggactcaggaaagtgaatctgctccagggtacttcctgaaaggc
ccaaggagatcctagctcacctatattccacaagcccatgtcttttgttactacatccag
cagctcagtgtcttctatgtgccaacctctctgagctgggcactggacgcaagtgagtcc

Exon  4 +       7881       8002   2   Internal    122   100   Excellent
catgtactggcagctctgcccagcccataccccaaatacgcccattaactaaagggccct
gcagcctataaagtgatgctataaaggttcagtgttcagcctttgaaattcaaggcctgg
gctgctctattgcagtacttagcatgtccccatcctgtctgtttctctctcccatctcag
GGTGACCGAATCCCACCATCTGCACCTGTACATGCCAGCCGGGATGGCGTTCATGGCTGC
TGTCACCTCCGTGGTCTACTATCACAACATCGAGACTTCCAACTTCCCCAAGCTGCTAAT
TG
gtaggtgaggtgtaggagggaggggcagtaccttcattcatttcttcagataatgtttac
tgaggactcattatgtgccagctattgctctaaacagtagagatttggaatagaaaaaga
aaaaaatccctgccttcatggagcttacagtctggtgaaggaggatagacaggcaaagac

Exon  5 +      13024      13055   0   Internal     32    78        Good
cttctgatgcctgggatagaatctgtccggcagagtggagtggaggcagggggacagcct
tcagctgtggaattcctccagtcctagagaccagcctgagctgggggacattattccagt
cctgaggcatgagagcagaaggccgatgcttctgccctccatcctaatgtcctcctgcag
GGACCCAAGGTGGATGGCATCGATCCCCCCGG
gtgagctcagccctgggcgcatggtggggcccaacatctcaacctgtttcctaaccctga
gccaggcaggacagatcccagatttgtgcccaagagatgctctggcatccatgcccaggc
ccacatagggatagagggcagggtgaaagtctctctccctcactcgggtcctctggagag

Exon  6 +      14499      14665   1   Internal    167   100   Excellent
tgcgtcatcttagagtcatgtactctgatatattcacacgtgcacatccacttactcgga
aatgtacacacccaggcacgcttattctgtctccttctctgccacatacttgcacacatt
atgtgagtgtacacacatgatgcacacacgtctctgcgatcttccatctctcctcggcag
CCCTGCTGGTGTATTGGACCCTGGCCTTCATCACCAAGACCATCAAGTTTGTCAAGTTCT
TGGACCACGCCATCGGCTTCTCGCAGCTACGCTTCTGCCTCACAGGGCTGCTGGTGATCC
TCTATGGGATGCTGCTCCTCGTGGAGGTCAATGTCATCAGGGTGAGG
gtaagcaggccacctgggccagggtggggtgggaagcagaggctctggcctctgtcctgc
cctgggttcaggcccccaccctgcttctcagccaaactgagaagggatcagcttgtttta
cccgcccgtgtaaaggggagtggggccgtggcggaaatttcaggatagacactgcatctg

Exon  7 +      16278      16517   0   Internal    240   100   Excellent
gacattggtggccaagaagtgttggggaatccttttcctggtaataattacaggcgaaag
atggccccatctgttagagatcaagtgtggaatatcacaaccccagatccttgctggggc
aaggtagggagtggtgagaagttggacttacccatcccccatggcccatgtgccccacag
AGATACATCTTCTTCAAGACACCGAGGGAGGTGAAGCCTCCCGAGGACCTGCAAGACCTG
GGGGTACGCTTCCTGCAGCCCTTCGTGAATCTGCTGTCCAAAGGCACCTACTGGTGGATG
AACGCCTTCATCAAGACTGCCCACAAGAAGCCCATCGACTTGCGAGCCATCGGGAAGCTG
CCCATCGCCATGAGGGCCCTCACCAACTACCAACGGCTCTGCGAGGCCTTTGACGCCCAG

gtggtcagtgggggcacagccacaccatctattcactgccttctggtttagggtcacaga
gagggacctcaaagggcattaggtcaaaatcctggtgggacaagaggggaaactgaggct
ggtgaggggaagaagcttgccttaagtcacacagtgaaccagggacaggtgcagggctga

Exon  8 +      17082      17120   2   Internal     39    65    Marginal
gatccttatggtaactctatgagttgagccagacaggaatctccccatatcactgaggag
caaattgaggccctgagaaaggctgtgacctgcccagagctggccacagctggcaggcgg
cagaggcagtctcctggctcccagtccagtgctccttcacttcctctgccctcgcaccag
GGCAGTTGCTGAGGCAGACACGGTGGCAGGTGGTAATGA
gtgagtgtggcacatggccacctcctcattccagtgctgtgctcatcacatagtccctga
ccagctgtgtgaccttgagcaatcatctggccttagtttccccatctagaccatgttggt
gttgatagggccctcccaactgtgcacttgctgattccatgatctcttcctggagttcac

Exon  9 +      17427      17615   0   Internal    189   100   Excellent
agggccctcccaactgtgcacttgctgattccatgatctcttcctggagttcacctattt
gcagaggatgtgaccactgggtttccccagacaacaggagctaggggcatcctgggaggc
taggcccagccgtgaattagccctcaggcactctgacctggccatggtctctctgggcag
CGGAAGGACATTCAGGGCACTCAAGGTGCCCGGGCCATCTGGCAGGCACTCAGCCATGCC
TTCGGGAGGCGCCTGGTCCTCAGCAGCACTTTCCGCATCTTGGCCGACCTGCTGGGCTTC
GCCGGGCCACTGTGCATCTTTGGGATCGTGGACCACCTTGGGAAGGAGAACGACGTCTTC
CAGCCCAAG
gtaggcagccccaggggtagggtaaggcaccctctagatggttttcagttgtttctgaga
gtgcaacaggccaatgtgtgtgagccatggccacactggagtggctcctcacacatgcgc
aaagcccatagcagtatccccaccacagaatactctacatctggtcaacagaaatgccag

Exon 10 +      19905      19994   2   Internal     90    87        Good
tagttcatctgaacgttatcattgccgtttttttctctttgtttatacacaaaccctggg
gtttattaccgtctcattggaatgctcttgtcccagttacttagcacacaaatccctgag
acagatggccctgcctcagtggcagtgggccttatcagatttaatattttttccctgcag
CCCAAACACAATCAGAAAATTTCCGACACAGAAACAAGAGTTGAAAGTAAATATAGTCTC
CAGTGTCCGCAACAAAGAACTCTCCATCAT
gtggttgcctgggatgtggcttaattctcatgtgggcttctgagctcagaaaatggggga
aagggatcatttactgagatcatttggttcatctcccagcccccaagccattctaatcca
gagagaaccgagtgctattctggtctttatgaatgacaaagaaggaagctccctagctac

Exon 11 +      26494      26601   0     Single    108    41    Marginal
agcttggtctttattcttgacagctatatatgcactgctagaaattctctgtgcaaagag
gagaatgggcattgggaataactagatgcagctatgcctagtgatgtccatgaagttgtg
gtaaaatcctgaagctaccttgttctttggaaatgttcctcagaatcattaacattagtc
ATGTGGGAGACAGGAGAAGAAGCTCTGCAGAAAAGGGACCGAGAGGACAAGGATATAGCT
TGGGCTGGGGACAATGTCAGAGTCCAAACTCTGGCTATCTTGGAATAG
tctgtgtgaacggtgccctcccaagttgtgcagtgcacaacctgtgcagctatatatggc
aaccctgcccatccccagtggtttctcactgggaaagcagagtatttcctcagggatgtc
attatgtgacaatagtggaaaaagcccaggaaaatctaagaccttctaagactcatgggg

Exon 12 +      28451      28583   0    Initial    133    61    Marginal
catggtgtatattagctcacagaaagacatagaataggttcctgccttaagaaaacctga
cccacaaaaaagcctgggtttacacaaaagaggaattaagggcggggagcccaccttaca
acagaatgaataatagaattttatccaagagcaggcatcctgaggacatttaagacccgg
ATGCATTTTTCCTTGTTCAAGAGCACACATCCAAAAATTGCAGTCTTTCTGCGAGTCATG
ATCACTCTGCACATAAAGCGTTTAGGTTCAGAGCTCGGGGAGGCCATTACCATGGCTGCT
CTCTGTCTGCCCT
gtgagggtccttggggtggctgcactctggggatggtgctggggctgactgactcacgcg
gtcgtgtaacacatcagaccttccaaagtcgaacccttgttttgtttcaaggctcaatta
tgacaggacttggtctcagagcagatcccctccctaggctggagaaggccactttaaaac

Exon 13 +      29453      29662   0     Single    210    59    Marginal
gtaagttggaacggtgatacagtaccaccttacagagctgctctagggcaccatggggac
tgtctgagaagcccctggcacactgtaacaggtggcatctggtgtggtgatgatgatgag
aatgatgatgaatgtgaaacactctgctctcatttctagaccaagatttacaataaaatt
ATGCACCTGTCCACCTCCAACCTGTCCATGGGAGAAATGACTGCTGGACAGATCTGTAAT
CTGGTTGCCATCGACACCAATCAGCTCATGTGGTTTTTCTTCTTGTGCCCAAACCTCTGG
GCTATGCCAGTACAGGTACTAGATGGGCTGAGGGGAAGGGAGGGGGGCAGCAGGACACAC
AACCAGAATCTGCTGGTCCATGGCCAGTAA
ctaggagcacaccgtcttccactccatgcttgcctgtacctttcacacacttggctatac
cacaggctgtacctctgggtccctcctgtcccatactctgcaagcactgaccatctctct
taatgaccagagaaggcagtatcattaagactttaaaaatggagccaactttataaacta

Exon 14 +      33541      33663   0    Initial    123    47    Marginal
tcctccccactatgctagatttttttcctaacctgtgaataggagacaaaatagtccttt
tatttctcacagttgctttgcacactcagaatccatgatttcttctgcatgagggccatt
cagacctgtgcagaagagagtaatggaccaaggagtcttgggagcacctaggaggagggg
ATGGGGGAGCATGAGGAGGAGCCAGGGAACAGCAGCAGCTGCAGCACCAGCTCCCACCCC
AGCCTCTGCCAGTCTCTTGGAGGTGGTGTGGGTGCAGACACCGGCTCACAAGGTGCCCTG
TTA
gtgagcttggggtgccatgggagccttcttgttgtcaggcccaacccaagctggctgaag
aacaccctgatggcctccatttgagcacaactaatgaaggactggatgccagagataagt
ccaggagggtgatgctgcagggcaggccagggaagagggtacttcatctctatcatggtc

Exon 15 +      34791      34925   0   Internal    135    99   Excellent
tccttttgaaattgctttgtttctcctccttccctgcactccactccccaagataatttg
gaaacctgggcaccaaggcttgtcccactctaggggactggggaaacagggattttgcca
gcacctcctggcagggcaaccatcaggtcaaagggacctgacccatgaccccttcctcag
ATCATTGTGGGTGTGATTCTCCTCTACTACATACTCGGAGTCAGTGCCTTAATTGGAGCA
GCTGTCATCATTCTACTGGCTCCTGTCCAGTACTTCGTGGCCACCAAGCTGTCTCAGGCC
CAGCGGAGCACACTG
gtgagtgcccaaaggtgtgtgtgttttgtccctcttcccctccttccctcgacagcagca
ggtctcctcccacacacccacactgtcattgactttgactttgactttgagtaggccact
tcacctgtccaggcctcagcttctttgtctgggaaatggagtcaatgggggaggaggctg

Exon 16 +      35221      35383   0   Internal    163   100   Excellent
ccacttcacctgtccaggcctcagcttctttgtctgggaaatggagtcaatgggggagga
ggctgcctcccggtgaggacaggaggcgggcatggcagtgacagtattgacactcaggcc
ttcctctcgggtgggagacggagcagaagcctctcccctctgactcggggacccctgcag
GAGTATTCCAATGAGCGGCTGAAGCAGACCAACGAGATGCTCCGCGGCATCAAGCTGCTG
AAGCTGTACGCCTGGGAGAACATCTTCCGCACGCGGGTGGAGACGACCCGCAGGAAGGAG
ATGACCAGCCTCAGGGCCTTTGCCATCTATACCTCCATCTCCA
gtgagttcaccccacacagccagccctgggtgctgctgcgtacatgcaaggagagggtgt
cagagctcgggtaagagggggtgcagggacagaagcaggaggccttgagattatccgact
cagtaggggagcctcaaactggctctgatagctaagctcccagaaatcaaagtactcttc

Exon 17 +      40670      40806   0    Initial    137    56    Marginal
tttccttccccctctgttgactgcactgactattggactgaatgggaaacagccccgtgc
acctcaaaatgcacttcccctcctgcagatgcatcttgcaattaggcccaaactgtgagc
ctgcatgctcctcccctggccctgcacaggcaacaaagctgaagttaatcagaggtacaa
ATGGCTGGCTATGCCTCTCTGACACGTAACTTCTGGAACATGTATCAATGCTTTGGAAAT
GAAAAGCTCCTGGTATTGCAATGCCAGGCTGGTGCCCATAAGGGCCAGAAAACATTCCTT
GGGCAAAGCCAGGGGGA
gtgggtgatctgatcccagctcaggtttgttgatttgttgttttgtttgtttcgttttgt
atggggcaagggttgagggtatgaaaaacttacactatcatttactaccgtagtccccag
aacccagcacaccagcacaaggcctggaacagggataccttttttgaatgaataagtctt

Exon 18 +      45859      45899   1   Internal     41   100   Excellent
gagggaaatggggtgaggaactggaagtgccacagggctagagttctgcccctagcctac
tggagctgtgccccacaggctggccccactggactgcgctgcctccaagccatcctgggc
atctccatgtgtagctgtcacgctcctcccactaaacgcctccctgtgcttcctctgcag
TTTTCATGAACACGGCCATCCCCATTGCAGCTGTCCTCATA
gtaagtggatcctttctccatctcttgggggtagggtggagggggagggcgtctgcagtg
acaggctgcccagatttggcctttctgcacaggggcctcagaagacaggctccacagcca
gactgaaaataggatcgaaagtttatagagggtgtggcccctccccaactccagccgaac

Exon 19 +      47144      47289   0   Internal    146   100   Excellent
tgttggggacgtttccatgagatgactgtggggatgatgaaggtgtctccaactaaaaga
tcctcttaggagcctgctccctgacagccctctcatttcccttccagtgctgagcgtttc
cagtgtgggagggacccacaccctgggccaccctggcctcacttgtgcctctgtccacag
ACTTTCGTGGGCCACGTCAGCTTCTTCAAAGAGGCCGACTTCTCGCCCTCCGTGGCCTTT
GCCTCCCTCTCCCTCTTCCATATCTTGGTCACACCGCTGTTCCTGCTGTCCAGTGTGGTC
CGATCTACCGTCAAAGCTCTAGTGAG
gtgaggggagggtccgggcgagggcactgggcaggcaggtcctgtgtcagcctcaaggct
tgctcgagtgatggccaaaccacagctgtttggtcccggaacacacccccattgctgggc
cttgctgtagctggtcctggttggtcagagggacattggcctgtatggtttcccagctcg

Exon 20 +      49433      49538   2   Internal    106    85        Good
aaaccctggtaacaccaattacctgcccccatgcccactggtctgcccccttcagtgtgg
gctttgtgggactatacttcaggcctgagatcctgctcagagctctctatcaggctgcgc
cctctcccctcccctctgcccctggcaggggtgaggggtgtctctgtgcttcccgagcag
CGTGCAAAAGCTAAGCGAGTTCCTGTCCAGTGCAGAGATCCGTGAGGAGCAGTGTGCCCC
CCATGAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGGTG
gtgagtgcccggcctccccttgctactcccagcatggtcctctaaggcccaaaacttggg
cctgctgtgtcggacttctgccttttttcccaggaagaggggctcccttccctacacagc
tcccagcccagtgggtcctcacctccaaaccacccccagcccctcagggttgtgaaccgc

Exon 21 +      49698      49814   0   Internal    117    86        Good
gccagcaagtaccaggcggtggtgagtgcccggcctccccttgctactcccagcatggtc
ctctaaggcccaaaacttgggcctgctgtgtcggacttctgccttttttcccaggaagag
gggctcccttccctacacagctcccagcccagtgggtcctcacctccaaaccacccccag
CCCCTCAGGGTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGC
CCACTGCAGAGCCTGGTCCCCAGTGCAGATGGCGATGCTGACAACTGCTGTGTCCAG
gtgagtcctgctgccccatgcctggccacccagcaccaactcccagagggagctcagcac
ctggaaagccagaaagctgcatgcttagtcctctgcagaggtcaccctgcctgcctgtac
ggtccataggagtccagaaaccagggaccaccaagtggggggacccccagccttaggcaa

Exon 22 +      50155      50236   0    Initial     82    82        Good
ggacccccagccttaggcaagggtcagcatgagaaggccagtctcccactcccctgctct
ggaagtgatccaggggctggaatcagtgtcttttggctttcatggaggaggggaagccag
agactattcactgggaactggctgcctttctgttctctcctgggcggtgggacacgccta
ATGAAGATCATGGGAGGCTACTTCACGTGGACCCCAGATGGAATCCCCACACTGTCCAAC
ATCACCATTCGTATCCCCCGAG
gtatggcccagtccacccctccagcatgcccctccccatgtcccactgaataacatagag
ataaaaagacaaagctgcatttattgagcacctactctctgctcattcttggtgtatgcc
ctgggtatattatagaaggggaaggctacattctagaggcttccgtgtgctgggtgggag

Exon 23 +      50949      51058   1   Terminal    110    89        Good
gaggatgttgatttccagaaggaaaggattaaagagggagaggacttgctggggattcta
ggtaggaagaaagaaaacaggggccccagggttgggtgcatctgtctgtctgtctttctg
ggtaatggttgttcagactcccccggccccactcacatctgccaccctccctccctgcag
GCCAGCTGACTATGATCGTGGGGCAGGTGGGCTGCGGCAAGTCCTCGCTCCTTCTAGCCG
CACTGGGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGGAGCAGGTAA
tacatgtatcctcagggcccagtggaggggaaatctccttttaaccatcctcctcagttg
aggatgcacacacatttattggagggcccactctgtgttcagtgaggactcaataaatgc
tgctaatggatattctcatcatcatcactagtacgtattcacctcttactatgcgcaggt

Exon 24 +      52110      52258   0    Initial    149    57    Marginal
attctactataaagacacatgcagacgtatgtttattgcagcactattcacaatagcaaa
gacttggaaacaacccaaatgcccatcaatgatagactggataaagaaaatgtggcacat
atacaccatggaatactatgcagacataaaaaaggttgagttcgtgtcctttgcagggac
ATGGATGAAGCTGGAAACTATCATTCTCAGCAAACTCACACAGGAACAGAAAAGCAAATA
CCACATGTTCTCACTCATAAGTGGGAGTTGAACAATGAGAACACATGGACACAGGGAGGG
GAACATCACACACTGGGGCCTGTCTGGGG
gtggggggcaaggggagggatagcattaggagaaatacttaatgtagatgaagggttgat
gggtgcagcaaaccaccatggcatgtgtatacctatgtaacaaacctgcacgttctgcac
gtatatcccagaacttgaagtataataaaaaaagatgcatgtaaaataaaaccctttaaa

Exon 25 +      61641      61712   1   Internal     72   100   Excellent
actagcgattgccagggtctggtgggagagagagggaagggactgccaatgtgtatggga
tttgttttggggaagataaaaatgttttggaattagatagtggagatagttgcacaacct
ggtgaacgtacttttagtttcagaggttttctaaacctctgatttttttttaagtgacag
GAAAGACAGAAAAAAGTATATCTAAAAAGGCTCTAGGGGTGATCATGGAAAAGAAAGTTA
AGAAATATGACT
gtaaggaaaggagatgggtgtccctcaggccaggcagaaaattcagtcttgttgctttat
gttcatgtgcaaatctaaaaaatccaagtgatatagattaatgaggctctgagtccctca
aaaccttccctccccttacctctccaaaaaacacttgagataccctagaggtggtatgaa

Exon 26 +      63493      63591   2   Internal     99   100   Excellent
gacctctcaaacctgcctgggggaaggcaaggccaccagaggccacactaagcagatttc
taccaactgcacctccccatccccttgcctccatctgagccatcagcttgacaactgcct
ctgagaacaagcccctgagaatgccttccgcaccccctactcccgccctgctttttccag
GAAGAGAGGCCCCGTGGCCTATGCTTCGCAGAAACCATGGCTGCTAAATGCCACTGTGGA
GGAGAACATCATCTTTGAGAGTCCCTTCAACAAACAACG
gtaaaagcctgtcggagggaggcaggatgtggaggggaggaactgtctctggccagcctg
ccccagttccgggcccctccatcgatcacccacacccagccatctcactccccaggtgct
tacctgcactccagcctctccatatggtgcacctggagaggggccaggtgtgcctgagca

Exon 27 +      64625      64709   2   Internal     85   100   Excellent
aagtgctgacctcagctcttttcaagctcacacggtgtttgcttgcacccaagcgggagg
cctattaaagccattgctcaccctgggcatagctacccagagactaatgaccctctgcaa
gtgctcgggccaactctgaccaggctgaccagctgcatcccctgcctctacccacgccag
GTACAAGATGGTCATTGAAGCCTGCTCTCTGCAGCCAGACATCGACATCCTGCCCCATGG
AGACCAGACCCAGATTGGGGAACGG
gttagtagcagcctctgaggggttttttcaaagccaggacccccaacctaccatgccctg
agacactactcaggacaatgggtaactaggaaataggagacattgaaggctgaagagttg
cctgcagtaaggtcaaacatgttgttcttgatgatgtcctttgacaggttttcagtcctg

Exon 28 +      65357      65437   0   Internal     81   100   Excellent
gccctcttctgaatgaattcagtaaacacgtgcaagttccttctctatgcaaggtgagaa
gcaggcaaagaagtggatagagccaggcctccatcccaaagagctcatagtccagtaggg
tacaggacagtgtctcctgaatggctgagggcatgatgtgttcctcctctttggtgacag
GGCATCAACCTGTCTGGTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAG
CACGCCAACGTTGTCTTCTTG
gtgagtgcaagttcccttggggtcctggtctctggctgcctcccaggcctaactgcccac
ctccacctccccgcaaccccaccatcatccaacaatctccctctccaggagtaaatccct
cctgccagagatattgccttatcatcctagtgatagggaaactgaggcaggcaaggatag

Exon 29 +      67450      67587   0   Internal    138   100   Excellent
attttaaatgaggtaaccaaggcccagagaggttgggtgagttgtccaaagccacacagc
taactagcttcagtccctagagcagagttgatagaactctaatgggttttatactcattg
tcacccctccccaccatgcctttccctaccctctactctcttcctctcccttctgcccag
GATGACCCCTTCTCAGCTCTGGATATCCATCTGAGTGACCACTTAATGCAGGCCGGCATC
CTTGAGCTGCTCCGGGACGACAAGAGGACAGTGGTCTTAGTGACCCACAAGCTACAGTAC
CTGCCCCATGCAGACTGG
gtgagggggaacaagggggtcaggctatagggggcagggctggggaggctgtcaggcatc
ttggcaggaaccaatccgttgtcttggtagcaactgctgagggccacaaagcataagaga
ccagcactggatggctttatgcatgctgggcatttcagggagaccctgtacaggccaggg

Exon 30 +      69550      69711   0   Internal    162    99   Excellent
gagaaatacgcctcagatgtaccgaactctaggtcctaggagtatgttggttggggtagg
ttatcaataccagcccacttgcagtggatgagctggtggccatttgtagtgaggaaaggg
atgtgtcaacctccatcttagactccacaattgagggatgtgaccaccattcctccccag
CCAGCCCCCAAACCACGTTTGTTGCTGCCTTTCCAGATCATTGCCATGAAGGATGGCACC
ATCCAGAGGGAGGGTACCCTCAAGGACTTCCAGAGGTCTGAATGCCAGCTCTTTGAGCAC
TGGAAGACCCTCATGAACCGACAGGACCAAGAGCTGGAGAAG
gtgggtatatccagggatggccaagcagccacccctggatgcaaaggttctgctagaacc
tgaactcataaaggtcttcctgtccttagtgccccaggaagccccctaaagggcagatgt
gggagctgggcatgaactggctcctaccagaggagagacagtacctgtgccaggtgccca

Exon 31 +      70650      70749   0   Internal    100    63    Marginal
tgatgaaggggaaggactaaatcctggcaagatgaatgtgtgtctgtctgcccctccctc
aggcagggacaaagtagaaatctgacattggtcatcaccagagtagttaccccttaactt
ccccttcccccaccaaccatatatcctgaagacattgcccaggccacatctgtcttttag
GAGACTGTCACAGAGAGAAAAGCCACAGAGCCACCCCAGGGCCTATCTCGTGCCATGTCC
TCGAGGGATGGCCTTCTGCAGGATGAGGAAGAGGAGGAAG
gtacaggcaatgggactgggagtgaaattatggcctgaggtctgatcagccacagagagg
ctaaggtttggggttctgggtgtggtgcagtagtgtgcctttgattaaatggcttccctc
tgtgtgcccccgttgtcccctcagtaagtggggataaaatgccctgattcaccctcagag

Exon 32 +      70974      71215   1   Internal    242    99   Excellent
atcagccacagagaggctaaggtttggggttctgggtgtggtgcagtagtgtgcctttga
ttaaatggcttccctctgtgtgcccccgttgtcccctcagtaagtggggataaaatgccc
tgattcaccctcagagggatggaaatgtgtagccacagagtgggttcttgcggcctgcag
AGGAGGCAGCTGAGAGCGAGGAGGATGACAACCTGTCGTCCATGCTGCACCAGCGTGCTG
AGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGT
TGCTGGTCTTCTCACAGCTGCTCAAGCACATGGTCCTGGTGGCCATCGACTACTGGCTGG
CCAAGTGGACCGACAGCGCCCTGACCCTGACCCCTGCAGCCAGGAACTGCTCCCTCAGCC
AG
gtgtgactggcggcccatggcagaggttgggagtggggatgggggaagggctgagcccat
gggcaccctggaactccaaatcactctctgcctgtgaaggagtgcaccctcgaccagact
gtctatgccatggtgttcacggtgctctgcagcctgggcattgtgctgtgcctcgtcacg

Exon 33 +      71333      71511   0   Internal    179    67    Marginal
gccaagtggaccgacagcgccctgaccctgacccctgcagccaggaactgctccctcagc
caggtgtgactggcggcccatggcagaggttgggagtggggatgggggaagggctgagcc
catgggcaccctggaactccaaatcactctctgcctgtgaaggagtgcaccctcgaccag
ACTGTCTATGCCATGGTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTC
ACGTCTGTCACTGTGGAGTGGACAGGGCTGAAGGTGGCCAAGAGACTGCACCGCAGCCTG
CTAAACCGGATCATCCTAGCCCCCATGAGGTACCCGTCTCCCCTGGCCAGGCTGGGACT
gtgagcaagtcactgttctctgagccttagtcttcccatctataaaatggggatatacaa
cctgtcacaagcttgtgggggtgactcaaggagacagtgtgtgtaaaagtgccctccttg
tgcaagaagcagggagaaactggcatttactcagccagatactgtgataggcattgtgtg

Exon 34 +      73434      73591   0   Internal    158   100   Excellent
gcagaggctgccgtgaaccgagattacgctgctgcactcaagtctgggcaacagtgagac
tcagtctcaaaaaaataaaggatcaaaaaataaagtgagagcaaaacatggcggccagta
gcactctaaacacagtcaataccaaaattcacctcactctctccccctcgtctccctcag
CACATCCCATCCACGCTGGAGTGCCTGAGCCGCTCCACCCTGCTCTGTGTCTCAGCCCTG
GCCGTCATCTCCTATGTCACACCTGTGTTCCTCGTGGCCCTCTTGCCCCTGGCCATCGTG
TGCTACTTCATCCAGAAGTACTTCCGGGTGGCGTCCAG
gtgatggcctcaggggtgaggggtgggaggtgctttgcaatgtgcagtttggtgtacttg
ctagactcatcgttatgagagtaatagggtcgtgttccctccaaaaaataaaaacaaaaa
acagaaatgaaggaaatagaaatatccacatcttattccaccgccctaatataatagtct

Exon 35 +      74309      74383   0    Initial     75    42    Marginal
gttctctagggagttctttctgggagtgattctcccagattcatagaaactcatagattc
aaaaaattgtaggaaaaaatttaaagaacgtctaggccagtgtttctcaaactgccaatt
acagcccatcagtgggtcatgaaatcaatatcatggatcacaaccagcatttttttaaaa
ATGAAAAAAACATCAGACTGTATTCATAGAGTAAAGCAAGCTTTGCTTCATGAAACCTTT
GTGTTGGTCATGGAG
gtgtgtgagtactgatttgtgagataaaatatatttctgactgcaggttgtggtcagaaa
ggttaagtacctttcccaagtgcacatagttggctagaaactagagttgagatacttatt
agcaataataaaatttagatgcattttggacacaattacctgccccaaaggatcaacatt

Exon 36 +      75350      75442   2   Internal     93   100   Excellent
gtgctcacaaaagctcaatgggctggtggcattgtcttcccccttcacggggtaagaagc
tgaggcctagagaggtaaggccattcacccacacagcggtagcaggtggagctaggcttc
aggcccaggccgagccctgagcctgccctcttaactgttccactctgttccccgccacag
GGACCTGCAGCAGCTGGATGACACCACCCAGCTTCCACTTCTCTCACACTTTGCCGAAAC
CGTAGAAGGACTCACCACCATCCGGGCCTTCAG
gtacgagtccacattcccccaaggtaggagtggaacaggggtggggccagggggcacagg
ccatgagatttgattctcaggactccacttgggaaggccaaggacacgttctctctcaag
ctgcctcaggtcccaaggcccaagggatatccaccagcagggacaggccaggtgggctcc

Exon 37 +      79662      79768   2   Internal    107    95   Excellent
tttgaataagcagaaaggagtggggtggacattccagagagggatagcttacatgaagtg
gccacggtggcatgtctggggactggaggggccctggagcctccctctgcaggtagggag
actcctaggagctatgtggaccaacactgttcccttaggagcttctcatcctccctccag
GTATGAGGCCCGGTTCCAGCAGAAGCTTCTCGAATACACAGACTCCAACAACATTGCTTC
CCTCTTCCTCACAGCTGCCAACAGATGGCTGGAAGTCCGAATGGCAA
gtgctattcccctctaccctggcctctgataggagggtggggccagagcaagagcacaca
ggtacctggggatgaaagagaggataggataccagatcgtgtggacaccaagccttcctg
cttcccccagccctggtggtcctcctagtgtctagcctgtgctccttttccccatatcac

Exon 38 +      80284      80419   2   Internal    136   100   Excellent
ggagcatgagcttgtgggacatgttggctcctggggctccagccttcgcagcccttgtgt
gtgtctggtgacgtgtgcatgagttgcagggctggagtggaggcctggctgagctgctct
ctgccccgaaaaggagtgaggtagaacaggggcctgtggctctaacccctgagcgcccag
GTCAGCTCCTCTCCCTCCCCAGGAGTACATCGGTGCATGTGTGGTGCTCATCGCAGCGGT
GACCTCCATCTCCAACTCCCTGCACAGGGAGCTCTCTGCTGGCCTGGTGGGCCTGGGCCT
TACCTACGCCCTAATG
gtgagcggcagtgggctagggcagaggaggggtcagacaccagcactcccggagcacctt
cgtcactggagacatgagacactcccaggccttaccccaatttcatttgcatctgatgcc
agagggacagtgcgggcaggaaggctgaccagcaggccccagggcccaggccccagacag

Exon 39 +      80790      80910   0   Internal    121   100   Excellent
gggagccacatgactgaccctccctgtgcctccagggagggctgctctgagcaggcagtg
gatggcagcaaaaggaatctggggccctggcccctctccagccttaagaagagccattct
ggtggctgaggacagaactaagcgaccatggagtgtgcgccactggcttgctccccacag
GTCTCCAACTACCTCAACTGGATGGTGAGGAACCTGGCAGACATGGAGCTCCAGCTGGGG
GCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCAGAGAGCTACGAGGGGCTCCTG
G
gtgagaggctcagggagaggggtggggaagagtccaaggaggagtgtgtctgggttgggg
gccacaagggagcctggggatggggtggcactttcggatactagctgtggcccatgcctg
gtggctgagcccagcccggcccccagcaccatcgctgatcccaaagaactggccagacca

Exon 40 +      81045      81187   1   Internal    143    96   Excellent
catgggctcctgaaaaccgaggcagagagctacgaggggctcctgggtgagaggctcagg
gagaggggtggggaagagtccaaggaggagtgtgtctgggttgggggccacaagggagcc
tggggatggggtggcactttcggatactagctgtggcccatgcctggtggctgagcccag
CCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGGAAGATCCAGA
TCCAGAACCTGAGCGTGCGCTACGACAGCTCCCTGAAGCCGGTGCTGAAGCACGTCAATG
CCCTCATCGCCCCTGGACAGAAG
gtcagagcacgggcccaacccaatgctgcaggacaggcgtgagcaggggatggggcatgc
acggagctggatggcttcgcagtcacctcgtggccctccagggccgaggcctctcactat
tcagacatcgcagtctcctgccctgggcctgtgggggcccatctttcctctccttctatt

Exon 41 +      82173      82251   0   Internal     79   100   Excellent
ctggacccactgcaggaaacaagcccaaacctgtggtgtccaaagagaaactagtcagaa
aaccaggccaaaaagataccctgtgacctcccacacctgcacacacacccagagctagca
tagaggctattcccagcagccccagagtcccagtggcggtgcctgcttctctctttccag
ATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCTTCTCTCTTGCCTTCTTCCGC
ATGGTGGACACGTTCGAAG
gtgagttgtaaggcgggcaccccacgtgtacccacagccaccagatgaggcctcagccct
ggcacgtggtcagacatgacaggaggcccagcagtcaccgccttcccctgcaccctcact
gggacccatgcagggcacatcatcattgatggcattgacatcgccaaactgccgctgcac

Exon 42 +      82385      82493   1   Internal    109    99   Excellent
gtcctccttctctcttgccttcttccgcatggtggacacgttcgaaggtgagttgtaagg
cgggcaccccacgtgtacccacagccaccagatgaggcctcagccctggcacgtggtcag
acatgacaggaggcccagcagtcaccgccttcccctgcaccctcactgggacccatgcag
GGCACATCATCATTGATGGCATTGACATCGCCAAACTGCCGCTGCACACCCTGCGCTCAC
GCCTCTCCATCATCCTGCAGGACCCCGTCCTCTTCAGCGGCACCATCCG
gtgagccccaccacccctcaggcccacccagccccaggccggctcagttccatcagatct
ggagcacaaagaggagggggttgggggagaccaggatcccagaggtgtttcctgctcatg
cccttctccatcccatcaggcccaggcagcctctggaaggggatcccccacccatgggtc

Exon 43 +      82828      82931   2   Internal    104    65    Marginal
ggaaggggatcccccacccatgggtctaagatgctgtcccccacccactgccaccacctc
ggtgcttctcccagccagacctccaactcagtctgctctcgctcactgccctctttgccg
cctggggatgcaggcaggaccctgctccctccctactggggctttctgtgccacttccag
ATTTAACCTGGACCCTGAGAGGAAGTGCTCAGATAGCACACTGTGGGAGGCCCTGGAAAT
CGCCCAGCTGAAGCTGGTGGTGAAGGCACTGCCAGGAGGCCTCG
gtaactactcctggctatgcagctgggttggttgggcactcaaggaccctgtaaggatgg
cagacagaagcccgtgtctcaggtttgccccaagtttggagtctgaagcctggcaggacc
atttagtcctacttctcactatacgggggcccagagaggtcaggtgtcttgccccaggtc

Exon 44 +      83704      83837   1   Internal    134    99   Excellent
acggcctccacattgttgtgtcaggtgcaccagccctgcacacgcctgtgctcttggaca
cacacccacctatttgcccccatgcacacattttccaacagccccccaagccatcccatc
tgctccactcacagcacaagattaactcagtcctacttcatctccccgggctgttttcag
ATGCCATCATCACAGAAGGCGGGGAGAATTTCAGCCAGGGACAGAGGCAGCTGTTCTGCC
TGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCATCATGGACGAGGCCACGGCTTCCA
TTGACATGGCCACG
gttggtcctgggcccctccatgggaccatggtcttggaaagggtttagtgggatgctagg
gagaaatttgcacgaagtagtcctgaggctcaagttgcctctaacatcaaatgctatgtg
ttgcagaaaatgaaaagagctggggggaccctgactctgtctagtcttagggaatgttac

Exon 45 +      84312      84406   1   Internal     95    87        Good
acaacctacatacacacacagagctgagctcccaacaggctgagtccagtccctgagtgc
cgggaacctgttcagtcctgtggggtgggggtgggactaggatcggggtcagatgggagc
tgagccacagacctgggctccacatcccccaagccaggccagaccccatccactgggcag
GTGAGCCAACAGCTGTTGCCCCCACTTGGCAGGAAAACATCCTCCAAAAGGTGGTGATGA
CAGCCTTCGCAGACCGCACTGTGGTCACCATCGCG
gtaaggggcccattgatggggtgcagagggacacccagggacaggactggcctgttgtgg
ccgtcatcagtgcacagcccctgggcttgcctggtcccagtaatcaagaaagaaccctga
agcaggcagttcagggcaaggggcctggagggcatgcagggagcctgggttgcaggattt

Exon 46 +      84975      85112   0   Terminal    138    96   Excellent
gcagatggagagcttgtagtcacatccaccccaggaaagtgcagtccccacagtgacagg
acattctggccacatgcctcatcctcctcctccaagccgcaggagggccaccctcagctg
tggcccccaccgcgggtggtattcccaccatcctgacccgccccctcctgccctgcccag
CATCGAGTGCACACCATCCTGAGTGCAGACCTGGTGATCGTCCTGAAGCGGGGTGCCATC
CTTGAGTTCGATAAGCCAGAGAAGCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTC
GTCCGTGCAGACAAGTGA
cctgccagagcccaagtgccatcccacattcggaccctgcccatacccctgcctgggttt
tctaactgtaaatcacttgtaaataaatagatttgattatttcctactagaggccctaag
tctggtgggcaggggctggcggtggatggtgggttcagtagaaccagcctggctctgaca

--------------------------------------------------------------------------------