Gene SLC18A2 Variant 1
DNA : 36.21 KbNT_030059
mRNA : 1724 bp NM_003054
CDS : 1545 bp NP_003045
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  40 bp
cagcgacggcgcgggcgggcggaggccggggcgccccagccccccgcccccgctccctcc
ggccgtgacgtcagagccggacggggtaaactgagcggcggcggcggggcgctggggcgg
agactgcgacccggagccgcccggactgacggagcccactgcggtgcgggcgttggcgcg
GGCACGGAGGACCCGGGCAGGCATCGCAAGCGACCCCGAG
gtaacacggccccggttccctgctcgcagggcgcggtgccggaggggagcgggcccgggg
gaggcagggaggcagggaggcccccagagctacgcgggcggggctgcggggaccccgggg
cagccggggcgcagggcgcagggcgcaaggtgcacggggccgagcgtgcagtttgggagg
EXON 2  136 bp
cagggagcgcgggctctcgtggggacgcgctcgaggcaggtgagccgaggctggggcgcc
cgggggtgtccccggatgccggtgcgcgcggctccctgacccgcccttccgcggcctggg
ggacgggagaatggggggtccacggccgccttgggtcctcaccgcgcaccgcgcccgcag
CGGAGCCCCGGAGCCATGGCCCTGAGCGAGCTGGCGCTGGTCCGCTGGCTGCAGGAGAGC
CGCCGCTCGCGGAAGCTCATCCTGTTCATCGTGTTCCTGGCGCTGCTGCTGGACAACATG
CTGCTCACTGTCGTGG
gtacgtgcggacagggcacccctgccccggcaccccagccccagcgccccttccccggca
ctccacttacccctgcgcggtcccggagctccgccaaggcccgggaaagttggagaactc
gctttgcaaaaaagacatcccctccaggctgccgcgccggggctaggaggagccgcgttg
EXON 3  343 bp
ggccagcctggtctcgaactcctgacctcaggtgatccacctgcctcagcttcccaaagt
cctggaattacaggtgtgagccactgctccctgccgacacaaccatagttttttgctggc
ttttttcctggagagggtttcagtgtgatcaccaccttgccattctgctcttatccccag
TCCCCATCATCCCAAGTTATCTGTACAGCATTAAGCATGAGAAGAATGCTACAGAAATCC
AGACGGCCAGGCCAGTGCACACTGCCTCCATCTCAGACAGCTTCCAGAGCATCTTCTCCT
ATTATGATAACTCGACTATGGTCACCGGGAATGCTACCAGAGACCTGACACTTCATCAGA
CCGCCACACAGCACATGGTGACCAACGCGTCCGCTGTTCCTTCCGACTGTCCCAGTGAAG
ACAAAGACCTCCTGAATGAAAACGTGCAAGTTGGTCTGTTGTTTGCCTCGAAAGCCACCG
TCCAGCTCATCACCAACCCTTTCATAGGACTACTGACCAACAG
gtagggcagactactttagtcaaagagtttgatatttgtatcagtcctagcttatgtcct
tcctggaattctgcttcttactcattggtgagagtctggaaaatccatggtgggtgagct
ggggaaaacccagtccccttcccctatgtctctgttcccagataaccacaatttcctatt
EXON 4  59 bp
cgttccaagacagtcaaacacaaaaaggtcacataggaagcactgagtatatgaattttc
agaaaagtccaccaaacacttatctgtctgatcccaaagggtagccaggcgaaaatcaat
ataaagccttaaaaaaatagcctgcagtcaccagatttgtctgatgtttgtgttttgcag
AATTGGCTATCCAATTCCCATATTTGCGGGATTCTGCATCATGTTTGTCTCAACAATTA
gtaagtgtgtggtgttttccttctgagtgtgggtctcatcagggtgggcattgatgccca
tgagccgggaattaacaatacaacctaaggacggcgggggggcggggggggtcgtggttg
gctcatgcctgtaatccgagcactttgggaggctgaggtgggcggatcatctgaggtcag
EXON 5  84 bp
aggtttgtgtattggcaacaattgcagaaaggaattgatagctttttacggaacaaaagc
acagggtggctaacatgcaaatgctccactgggttaaggggggcttctgaaacgttcctg
tttgggacggttgtgtcccagcagcactgatgtgcggtcttggaccccctctctcggcag
TGTTTGCCTTCTCCAGCAGCTATGCCTTCCTGCTGATTGCCAGGTCGCTGCAGGGCATCG
GCTCGTCCTGCTCCTCTGTGGCTG
gtaggtgtggaatgcctgagtgagttcgtgaggggccccttgcagagtgagctggactca
ttcagggaattcaggtattggtggtggttggggtgctggggattcttggagaaggcaccc
actttcctcttgggttctgcttggtcttacattttagtgaatctgacaggtttgggaaga
EXON 6  97 bp
tgctggggattcttggagaaggcacccactttcctcttgggttctgcttggtcttacatt
ttagtgaatctgacaggtttgggaagatcacaaggctggctggagagggaaggcgagtca
cgcattattcttttgctgttccccggagctggcctgttgactatttctttccctgtgtag
GGATGGGCATGCTTGCCAGTGTCTACACAGATGATGAAGAGAGAGGCAACGTCATGGGAA
TCGCCTTGGGAGGCCTGGCCATGGGGGTCTTAGGTGG
gtaaggcccccgtgtaggcaaactggcaagaggggcctgcctggtgctggacagcggcag
tcctcgcccagtgaccctggcgcagtttgcactgacacagaggtcccctttttatttttt
tcctttcctgctttcatggagactttgaaaaatggtaggaagagccctgagctgggggtg
EXON 7  87 bp
cacttggaggaagttgccaagacaactgaactctaaccgaacagaacaatagggcagcca
ccccaaagccttattggaacaaagtagagagagaaacacaagagtcaaatagatggttct
agtacagggagagggcatgtgtcccaggggtggtgtccccactttctctccctgcagtgg
GCCCCCCCTTCGGGAGTGTGCTCTATGAGTTTGTGGGGAAGACGGCTCCGTTCCTGGTGC
TGGCCGCCCTGGTACTCTTGGATGGAG
gtgagtgagtccacgtgggcgccatgccatgaccttggcatcgtgctggcacgcgcttgg
gccacacctgctttctgaagaggggcttgtcttttttatttttattttttagctattcag
ctctttgtgctccagccgtcccgggtgcagccagaggtaagcggctgggaatgagggccc
EXON 8  44 bp
gctctatgagtttgtggggaagacggctccgttcctggtgctggccgccctggtactctt
ggatggaggtgagtgagtccacgtgggcgccatgccatgaccttggcatcgtgctggcac
gcgcttgggccacacctgctttctgaagaggggcttgtcttttttatttttattttttag
CTATTCAGCTCTTTGTGCTCCAGCCGTCCCGGGTGCAGCCAGAG
gtaagcggctgggaatgagggccctgggggagggggcatggtgctgcttctgacccgtgt
ttttttcttgacagagtcagaaggggacacccctaaccacgctgctgaaggacccgtaca
tcctcattgctgcaggtggggctctgtgggtcttctgagtcaggggaatgcgaggtgatg
EXON 9  61 bp
acgcgcttgggccacacctgctttctgaagaggggcttgtcttttttatttttatttttt
agctattcagctctttgtgctccagccgtcccgggtgcagccagaggtaagcggctggga
atgagggccctgggggagggggcatggtgctgcttctgacccgtgtttttttcttgacag
AGTCAGAAGGGGACACCCCTAACCACGCTGCTGAAGGACCCGTACATCCTCATTGCTGCA
G
gtggggctctgtgggtcttctgagtcaggggaatgcgaggtgatggccgcgtgctggagg
caggggtggatggccagggctgattttcgttttgctgctagaaatgttgggctatataaa
aaaacagaaaaggcaaagaggctacaagtcaaaggaaatggttttcttccgccattgctt
EXON 10  96 bp
cgaccatgatgatgatgattatgataaacagcctttgctgtccccttgatatgcgattta
tcctttacttaatgaaagtagaagttgcggttatctgagctgtaggcgcatggagtctaa
ctgtgcctggaaatgagagaggaggcagaagccactacaaagccctttcctcccttacag
GCTCCATCTGCTTTGCAAACATGGGCATCGCCATGCTGGAGCCAGCCCTGCCCATCTGGA
TGATGGAGACCATGTGTTCCCGAAAGTGGCAGCTGG
gtaaggactggggtgggctcttctgattcaagagcatttgtccccagggcagcctttgtc
cccagggcatccctgctgagttgcccttatggggatgataaagtgattgcttctgtttga
ctcttaatggggtcattgcttagggcagccttggggtctgtttgttctctggtttatcca
EXON 11  79 bp
aggataagccacgtgggtccagaccggatccggcaggcgccggatattagctgctggggt
gtgggccccggggcttcgttttatctgctctcatcaacattgtggtgtctacagttatta
ctttttctaacatatgactgatatcagcactgataaggtctccttttcataaatttacag
GCGTTGCCTTCTTGCCAGCTAGTATCTCTTATCTCATTGGAACCAATATTTTTGGGATAC
TTGCACACAAAATGGGGAG
gtaagatgatatgaaaacaacactcattctgttacaataatgtagttctttcaaaaaatt
ctaagttgtttctgcctttgctgttacaagtaattgttttgattttcattgaaaatttgg
actagaaaaaaatcaaatgatcatttcttgatggtgctttttcttttggtaggtggcttt
EXON 12  52 bp
atggggaggtaagatgatatgaaaacaacactcattctgttacaataatgtagttctttc
aaaaaattctaagttgtttctgcctttgctgttacaagtaattgttttgattttcattga
aaatttggactagaaaaaaatcaaatgatcatttcttgatggtgctttttcttttggtag
GTGGCTTTGTGCTCTTCTGGGAATGATAATTGTTGGAGTCAGCATTTTATGT
gtgagtaaaagatggcatttgacaagtgggaacaatctgtgaataaaacttgcgctttgg
gcaagaatcaccaagaaacattttacgtttgagtttgttgatgttttattacagctttca
ttttattctaattttttatcatcttaaaaatgtttggacaagactttccaaggagtgtat
EXON 13  64 bp
ctttgacttttaaagatttggagggtccggttcttcacaaaccccacccttcttcctcct
gttttcttcagaagggaacaggcataccacgctcagagaaaacacaagttcaagactttc
cgagatgatttagagttggatctcttgttattttagcataatgtttatttcctcttacag
ATTCCATTTGCAAAAAACATTTATGGACTCATAGCTCCGAACTTTGGAGTTGGTTTTGCA
ATTG
gtaagtcacacgaaccttgtgcctacatttaaaaccgcttttccactaggaagggttctt
cttcctctggtagactgtagttcctcaacctaaatttccagaatcttagaaggaggctgc
aggcagcttagctaaattacagcctgtcgattctccgtgtaaagacacctgcttctatgc
EXON 14  120 bp
cagaaaaggcttccttcattctttctactcaaagattagtatcaccccaagacttgcagg
tggtgatgacagaaggggaagagctggcagggtggtgagtttaagacacactccctgata
ttcggcccattttgggtttacatccgttttctatacactgtgttccctgactgtcttcag
GAATGGTGGATTCGTCAATGATGCCTATCATGGGCTACCTCGTAGACCTGCGGCACGTGT
CCGTCTATGGGAGTGTGTACGCCATTGCGGATGTGGCATTTTGTATGGGGTATGCTATAG

gtaaggacattggcttttcataagaaccttttacctcaatacgtaatggataacgtctac
taaaattgtttaaatctttgcatctttcagtctacaagacatttggaagagctttatcta
attctctgtttcctgaaaggtccttctgctggtggtgctattgcaaaggcaattggattt
EXON 15  134 bp
cgccattgcggatgtggcattttgtatggggtatgctataggtaaggacattggcttttc
ataagaaccttttacctcaatacgtaatggataacgtctactaaaattgtttaaatcttt
gcatctttcagtctacaagacatttggaagagctttatctaattctctgtttcctgaaag
GTCCTTCTGCTGGTGGTGCTATTGCAAAGGCAATTGGATTTCCATGGCTCATGACAATTA
TTGGGATAATTGATATTCTTTTTGCCCCTCTCTGCTTTTTTCTTCGAAGTCCACCTGCCA
AAGAAGAAAAAATG
gtaagaaaaatttaggatgcagtgagcatttcttgataattttagcatggccttcctgat
agcttcctcatggtttcattctaaagccttcaaacataaatggtgagaattcctttttag
tttgtaccacatagagcagttacttcttttatttttttattactgtgaaagttatttctt
EXON 16  228 bp
tttagagtgtagaactacaggtcttttaggtcaggcgtctggcgattgctccaaatgact
ggttaatagcaagtaatactacatagttttcaaactaataatccttaaaaacagtaggtt
aaaaccatcttatctttatgaaacaagaagttaatatacttgcactttgctctcttttag
GCTATTCTCATGGATCACAACTGCCCTATTAAAACAAAAATGTACACTCAGAATAATATC
CAGTCATATCCGATAGGTGAAGATGAAGAATCTGAAAGTGACTGAGATGAGATCCTCAAA
AATCATCAAAGTGTTTAATTGTATAAAACAGTGTTTCCAGTGACACAACTCATCCAGAAC
TGTCTTAGTCATACCATCCATCCCTGGTGAAAGAGTAAAACCAAAGGT
tattatttcctttccatggttatggtcgattgccaacagccttataaagaaaaagaagct
tttctaggggtttgtataaatagtgttgaaactttattttatgtatttaattttattaaa
tatcatacaatatattttgatgaaataggtattgtgtaaatctataaatatttgaatcca