Gene PTER Variant 1
DNA : 75.74 KbNT_077569
mRNA : 2713 bp NM_030664
CDS : 1050 bp NP_109589
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  83 bp
agggtgtggccaggcaaaaacgcggggaacggccccggaccagggtggggcgtggcaagg
gtttgaagggcgtgtcctacgaagaggtagggcttggcaaggacccacggggcgtgtcct
aggactcggtgagggcgtgacctcgggccaggggcggggagagaaccagagggcgaagtg
GGAGGGCACAGGGGAGACTAAAAAGGCCAGGGAAGTTGGCCTGCCGGAAGTTCCCAGGGA
GAAGGCAGCGCGTTGTACCCGAG
gtaaggcttcttggagtcagagcaggagccggaactgtgggcccagtaggaagagtgggg
cccgacggcggaggccgcgcggccagggttcgctgcagagctccacgcgagggtcctgcc
ggaaggaaggattttctagccgctgcgcttgggccctgccgcctctccttaagtgcttga
EXON 2  79 bp
gtcacttgcagtaactttactaagtatttttagttttctgattttcagttgacttccacc
aatgcagataggaaatgtctttggagatgaagtcacttgctgttatttttttatatgctc
aagattctggctcttacactactgtccccttatccatggttttgctttttgtggtttcag
TTACCTGTAGTCAACCACAGTCTGAAAATATTAAGGTATTTTAAGACAGAAAGAGAGAGA
GGAGAGAAACCGCATTCAC
gtaagttttattccagcatattgttataattcttctattttattattagttattgttgct
aatcttttactgtgcctaaattataaattaaactttatcataagtatgtatatatgggac
aaaaacatagtatctacagggttaggtactatttgcggtttcacacatccactggggccc
EXON 3  480 bp
ttagatctgcagtggggatagattctgaagtcggcaggattgtgagatcgtatctctagt
tttattgatttgccttcttacatgggtatatgttcacagcctcccaccccttacggacaa
gagtttatgtgtgtgttaaatattctgattgtagttgtttgtttgtttgtttgtttttag
AAAAAAGAAATCCTCTTTTTAGAACATCTCTTGGTGGTACCATCAGAAATGTCTTCCTTA
AGTGGAAAAGTCCAAACCGTTTTGGGCCTTGTAGAGCCAAGCAAACTGGGCCGTACCCTG
ACCCATGAACACCTGGCCATGACCTTTGACTGCTGTTACTGTCCACCTCCCCCGTGCCAG
GAAGCTATTTCCAAAGAACCTATCGTGATGAAAAATTTATATTGGATTCAGAAAAACGCC
TATTCCCATAAAGAAAACCTTCAATTAAATCAGGAGACAGAAGCCATAAAGGAAGAACTG
TTGTATTTTAAAGCTAATGGTGGAGGGGCTTTGGTGGAAAACACAACCACTGGGATTAGC
CGAGACACACAGACGTTGAAGAGGCTTGCAGAAGAGACTGGCGTCCATATCATATCTGGA
GCCGGGTTTTATGTGGATGCAACTCACTCCTCAGAGACCAGGGCCATGTCAGTGGAGCAG

gtaaaaagcctaagttctttgacagtatttgttcataaattcagaacagccagaaccttg
gaaatgccctgggttcagaggtagctgggcatgctacggaaatttgctagctagcaaaga
catctgccagttggggccccagttagtaacactgtatttcataaagaaagtgccaatttt
EXON 4  266 bp
gttgatttttgatttggccagcaaaatgcctttttccttggccaatattaattgataaat
actgaatacatttttaaaagaatgaatgacaaaataaataaattcattcacatactgtgg
tggatctattttgataaatttcacaacctataaaatatattccttctcactcttccttag
CTTACCGATGTCCTTATGAATGAAATTCTCCATGGAGCTGATGGAACCAGTATCAAGTGT
GGCATTATTGGAGAAATTGGTTGCTCCTGGCCTTTGACTGAGAGTGAAAGAAAGGTTCTC
CAGGCCACAGCTCATGCCCAGGCTCAGCTTGGTTGTCCTGTTATTATCCATCCTGGACGG
AGCTCCAGGGCACCATTTCAGATTATCCGAATATTGCAAGAAGCAGGCGCAGACATCTCC
AAAACAGTCATGTCACACCTGGATAG
gtaagtaggctgtcttacaaatggatgcaaactgccatataattaatgcatgatcaaatt
aagaatctacagtaatcagtcaatgcaatactaatcacgcagagaaaaccactaactata
tggaaggtagtatttataaagtttcacaactgacatgaataaaagtcaatgctgccattt
EXON 5  141 bp
ctagtaacaaattgaacttactgttttatactcacatcattaagagccatttcagaagtg
tctgttactcgacttcaactatgttcttgttcttgtacattgtgtgcttaaaacttctag
tatgtacatgtggaaaatgggctcttcataataacagttcatctgtcgcattgtttctag
GACTATTCTTGATAAGAAAGAGCTCTTGGAGTTTGCTCAACTTGGCTGCTACTTGGAATA
TGATCTCTTTGGTACTGAACTACTTCATTACCAACTCGGCCCAGATATTGACATGCCTGA
TGATAACAAAAGAATTAGAAG
gtaaatatggtaaagcctctcatagcattccctttccctagccctttttgattgtcatat
ctagggaagtattagcaaagattcagaaaacagtaagcaggccgaaccacagacttgcag
agaaaaatatatctatgctgtttcagggagaaaaatctctctatattattttaaggagaa
EXON 6  1664 bp
tgcagcaatatttttatcgtcaccacacaatatttattaaaggtctctcagtacacacgc
cacagtagaagtcagtatctttacgacaagcacaataggttaatgagtaaaaagttgaaa
gcatcctgaaaagcgaaaatgaaagacaaatgacatctaatgagttaacatttttcacag
GGTGCGTCTCCTGGTGGAAGAGGGCTGTGAAGATCGAATTCTGGTAGCACATGACATACA
TACGAAAACCCGGCTGATGAAATATGGAGGTCACGGCTATTCTCATATACTCACCAATGT
TGTTCCTAAAATGTTGCTGAGAGGCATAACTGAGAATGTGCTTGATAAGATTCTAATAGA
GAACCCTAAGCAATGGCTAACTTTCAAATAGGATGGTTGCTTATGAATTCACACCTTGAG
TATAAAACTTGCAGAGAACATTCAGCGATTTCCAGTCCACTGTGAGATATTAATCAGTTA
CCTAGGACTAATGACAGATCATTTCCTTCTGATGAGAACTAGGAGGGTTTGCCTTCTCTG
AGACCAGCTATTACAACTGTGCCTCTAGGGAGTTACTCAGCCTAATTGAGCCCTATTATT
TTAACTTAACAAAATAAATACAGAAGTACCTATTTCTAAACAATGATTTAAAGTCTATAT
CCCCTAAGCGGAGTTGTTGTTTTTCTCCCTAATCTATCAGCTGCACTACTTGAGAAAATT
TAAAGTGTTTCTAGTTAAATTATTTCCTTCTTGAGCGATCTAATGTTTCTTGTAATATTG
ATGATCCTACTAATTATCCTGCTGTTCTTTAATTAATGCTTAATGAATAATATGGCACTG
TAAAATAGCTTCTGCAACAAGGGAAGTTAAATTTTGAGACTTTTTTCCCCAAAGGATACT
GACTGTAATACAATTACCAATTCACAATGATAAAAATATTTTGAAAGGTTAATTTTATAC
TGTCCACCTATCTATATATTCTTCTACTGAAATGATTTTGATATCTTTGGCTTTCCGGTA
TCTATTTTTGCCATACATTTTGCTGTTTTGCAAAGTTTGTATAAGAACACATAACACTAC
TGAATTATAAAAATTCAATCATAAAAGTCAAAATATATTACATAATATAGTTTAATGAAT
CATTACATTTATAATAACAAAGGCCACAATTTAATTAATTGGTAAGATATAATGCAAAAA
AAAAAAGAGAAATGTTTGCCTTATGTATATTCCCTTTATTTCCTTTACCTTTTGTTTTTC
CTTGGACCTAAACAGAGAAAATAATGCTTATGTATCTGAAGAAAAGGTCAGATCTATTGG
AAATGACAGCCCGATACTTGAGCCTCCTCTTTAAAAGGTATCCAGCCCTGATATTTTGTG
TAAATAAAATGTTTTTAAAACCTGTTAGTTAAAACACTTAGGTGATGGGCACTGCTGCTT
ATAAATTCATCTTTTGGTTGAATCCTCACTATGCTATTTGGTACCTAAAAATATTCTCCA
AACCCTTGCTGCCAGTTCCTCTTTGATAAATATATAGTTAATTCGAAATAAAATCCATTG
CAATTCATTTATGAGTTATCTTACATATCACAAAGACCAATTAGAATTAGTCATTATTCT
TGATGAAGAGTCTGTTTTTAATCATAAAAATCATGACAGTTACTCAGACCCAGGCATTTC
AACAGAGCTAACACCACCTTCAGATAGGCACACCATGCATAACTCTTGGGAAGTTGAGCT
TTGCTAAATAAAAGATATTTCTGCTGATCAAAGATGATCAAGCTTTCTGTGTATTGGAAC
AGAAAGTAACAAAGAGGAATGAGCCAGGAGAACAAACTAATTCC
tttaaataaataaaaaaaaaaaatgcaaatgtccttcaccagtaaagcaagcaaattttt
aaaatctctgtttttgaaatctactcgtcaaagagttttcagaggcaatgaaaggggaac
agatttttcattgtaatagtggaagttgtgtgatagttaggagatatcaacatgcatttt