Gene PTEN Variant 1
DNA : 102.94 KbNT_030059
mRNA : 3147 bp NM_000314
CDS : 1212 bp NP_000305
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1111 bp
cctcgcgttgctgcaaaagccgcagcaagtgcagctgcaggctggcggctgggaaccggc
ccgagcaagccccaggcagctacactgggcatgctcagtagagcctgcggcttggggact
ctgcgctcgcacccagagctaccgctctgccccctcctaccgccccctgccctgccctgc
CCTCCCCTCGCCCGGCGCGGTCCCGTCCGCCTCTCGCTCGCCTCCCGCCTCCCCTCGGTC
TTCCGAGGCGCCCGGGCTCCCGGCGCGGCGGCGGAGGGGGCGGGCAGGCCGGCGGGCGGT
GATGTGGCGGGACTCTTTATGCGCTGCGGCAGGATACGCGCTCGGCGCTGGGACGCGACT
GCGCTCAGTTCTCTCCTCTCGGAAGCTGCAGCCATGATGGAAGTTTGAGAGTTGAGCCGC
TGTGAGGCGAGGCCGGGCTCAGGCGAGGGAGATGAGAGACGGCGGCGGCCGCGGCCCGGA
GCCCCTCTCAGCGCCTGTGAGCAGCCGCGGGGGCAGCGCCCTCGGGGAGCCGGCCGGCCT
GCGGCGGCGGCAGCGGCGGCGTTTCTCGCCTCCTCTTCGTCTTTTCTAACCGTGCAGCCT
CTTCCTCGGCTTCTCCTGAAAGGGAAGGTGGAAGCCGTGGGCTCGGGCGGGAGCCGGCTG
AGGCGCGGCGGCGGCGGCGGCACCTCCCGCTCCTGGAGCGGGGGGGAGAAGCGGCGGCGG
CGGCGGCCGCGGCGGCTGCAGCTCCAGGGAGGGGGTCTGAGTCGCCTGTCACCATTTCCA
GGGCTGGGAACGCCGGAGAGTTGGTCTCTCCCCTTCTACTGCCTCCAACACGGCGGCGGC
GGCGGCTGGCACATCCAGGGACCCGGGCCGGTTTTAAACCTCCCGTGCGCCGCCGCCGCA
CCCCCCGTGGCCCGGGCTCCGGAGGCCGCCGGCGGAGGCAGCCGTTCGGAGGATTATTCG
TCTTCTCCCCATTCCGCTGCCGCCGCTGCCAGGCCTCTGGCTGCTGAGGAGAAGCAGGCC
CAGTCGCTGCAACCATCCAGCAGCCGCCGCAGCAGCCATTACCCGGCTGCGGTCCAGAGC
CAAGCGGCGGCAGAGCGAGGGGCATCAGCTACCGCCAAGTCCAGAGCCATTTCCATCCTG
CAGAAGAAGCCCCGCCACCAGCAGCTTCTGCCATCTCTCTCCTCCTTTTTCTTCAGCCAC
AGGCTCCCAGACATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATAT
CAAGAGGATGGATTCGACTTAGACTTGACCT
gtatccatttctgcggctgctcctctttacctttctgtcactctcttagaacgtgggagt
agacggatgcgaaaatgtccgtagtttgggtgactataacatttaaccctggtcaggttg
ctaggtcatatattttgtgtttcctttctgtgtattcaacctagggtgtgtttggctaga
EXON 2  85 bp
ttttatctttaccagtattaacacataaatggttatacataaatacattgaccacctttt
attactccagctatagtggggaaaactttcttttcataactagctaatgttttaaaaagt
attcttttagtttgattgctgcatatttcagatatttctttccttaactaaagtactcag
ATATTTATCCAAACATTATTGCTATGGGATTTCCTGCAGAAAGACTTGAAGGCGTATACA
GGAACAATATTGATGATGTAGTAAG
gtaagaatgctttgattttctatttcaaatattgatgtttatattcatgttgtgttttca
tttagaaaagatttctaagccacagaaaaagatactttgtgatgtaaactattattgtag
tgctctataatcattttttggcttaccgtacctaatggacttcagggggatacagttcat
EXON 3  45 bp
attactactctaaacccatagaaggggtatttgttggattatttattttcacttaaatgg
tatttgagattaggaaaaagaaaatctgtcttttggtttttcttgatagtattaatgtaa
tttcaaatgttagctcatttttgttaatggtggctttttgtttgtttgttttgttttaag
GTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCT
gtaagtatgttttcttatttgtatgcttgcaaatatcttctaaaacaactattaagtgaa
agttatctgcttgttagagtgaggtagagttaaagatacattttaacagaattgtattcc
taaaccgattaagtcaagaagtccaagagcattgttagatcatttagaaagtgtagtgat
EXON 4  44 bp
gggggtgataacagtatctacttaatagaattcttgttattacatgaaataattaatgtt
aaacacagcataatatgtgtcacattataaagattcaggcaatgtttgttagtattagta
cttttttttcttcctaagtgcaaaagataactttatatcacttttaaacttttcttttag
TTGTGCTGAAAGACATTATGACACCGCCAAATTTAATTGCAGAG
gtaggtatgaatgtactgtactatgttgtataacttaaacccgatagactgtatcttact
gtcataacaataatgagtcatccagattatcgagtgagatacatatttaagaattatctt
taaaaatttcaaaaattttaattttactgttgtgttttaggaaaaagtattgcataaagc
EXON 5  239 bp
caagagactattttctatttaacaattagaaagttaagcaatacattatttttctctgga
atccagtgtttcttttaaatacctgttaagtttgtatgcaacatttctaaagttacctac
ttgttaattaaaaattcaagagtttttttttcttattctgaggttatctttttaccacag
TTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTT
GTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTA
AAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAAT
TTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAG
gtaagttattttttgatgtttttcctttcctcttcctggatctgagaatttattggaaaa
cagattttgggtttctttttttccttcagttttattgaggtgtaattgacaagtaaaaat
tatatataaatacaatgtataatatgatgttttgatgtatgtgtatatacattgtgaaat
EXON 6  139 bp
gtattgatattgctcttatttattattgagctggatttaagtattaatcatttaaggtca
aatttctaatgtatatatgttcttaaatggctacgacccagttaccatagcaatttagtg
aaataactataatggaacattttttttcaatttggcttctcttttttttctgtccaccag
GGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAAT
CATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCA
ATGTTCAGTGGCGGAACTT
gcagtaagtgcttgaaattctcatccttccatgtattggaacagttttcttaaccatatc
tagaagtttacataaaaatttagaaagaaatttaccacatttgaaatttatgcaggagac
tatatttctgaagcatttgaacaaattaattagctttgttgttcaactcattgggctaaa
EXON 7  171 bp
aaatcttacattgtttatatttttatttcatttatttcagttgatttgcttgagatcaag
attgcagatacagaatccatatttcgtgtatattgctgatattaatcattaaaatcgttt
ttgacagtttgacagttaaaggcatttcctgtgaaataatactggtatgtatttaaccat
GCAGATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGA
CCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCTGTGTGT
GGTGATATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGCTAAAAAAG
gtttgtactttactttcattgggagaaatatccaaaataaggacagattaaaagctatat
tttattttatgacatgtaaggaactataatttgttttctattagatctgcaggtgttttg
cttactctggcattggtgagacattataagggtaaataatcctgtttgaaggaaaaggcc
EXON 8  225 bp
agattgccttataatagtctttgtgtttacctttattcagaatatcaaatgatagtttat
tttgttgactttttgcaaatgtttaacataggtgacagattttcttttttaaaaaaataa
aacatcattaattaaatatgtcatttcatttctttttcttttctttttttttttttttag
GACAAAATGTTTCACTTTTGGGTAAATACATTCTTCATACCAGGACCAGAGGAAACCTCA
GAAAAAGTAGAAAATGGAAGTCTATGTGATCAAGAAATCGATAGCATTTGCAGTATAGAG
CGTGCAGATAATGACAAGGAATATCTAGTACTTACTTTAACAAAAAATGATCTTGACAAA
GCAAATAAAGACAAAGCCAACCGATACTTTTCTCCAAATTTTAAG
gtcagttaaattaaacattttgtgggggttgttgacttgtatgtatgtgatgtgtgttta
attctaggagtacagctgatgaagaacttgcttgacaagtttttaacttatgtattattt
cgaagcagtgtttacgtagcagtaacatgaaagtttctaataaaatacccaatgtacaca
EXON 9  1088 bp
tgaacatcttaagaagagggtcatttaaaaggcctcttaaagatcatgtttgttacagtg
cttaaaaattaatatgttcatctgcaaaatggaataaaaaatctgttaaaaatatatttc
actaaatagtttaagatgagtcatatttgtgggttttcattttaaattttctttctctag
GTGAAGCTGTACTTCACAAAAACAGTAGAGGAGCCGTCAAATCCAGAGGCTAGCAGTTCA
ACTTCTGTAACACCAGATGTTAGTGACAATGAACCTGATCATTATAGATATTCTGACACC
ACTGACTCTGATCCAGAGAATGAACCTTTTGATGAAGATCAGCATACACAAATTACAAAA
GTCTGAATTTTTTTTTATCAAGAGGGATAAAACACCATGAAAATAAACTTGAATAAACTG
AAAATGGACCTTTTTTTTTTTAATGGCAATAGGACATTGTGTCAGATTACCAGTTATAGG
AACAATTCTCTTTTCCTGACCAATCTTGTTTTACCCTATACATCCACAGGGTTTTGACAC
TTGTTGTCCAGTTGAAAAAAGGTTGTGTAGCTGTGTCATGTATATACCTTTTTGTGTCAA
AAGGACATTTAAAATTCAATTAGGATTAATAAAGATGGCACTTTCCCGTTTTATTCCAGT
TTTATAAAAAGTGGAGACAGACTGATGTGTATACGTAGGAATTTTTTCCTTTTGTGTTCT
GTCACCAACTGAAGTGGCTAAAGAGCTTTGTGATATACTGGTTCACATCCTACCCCTTTG
CACTTGTGGCAACAGATAAGTTTGCAGTTGGCTAAGAGAGGTTTCCGAAGGGTTTTGCTA
CATTCTAATGCATGTATTCGGGTTAGGGGAATGGAGGGAATGCTCAGAAAGGAAATAATT
TTATGCTGGACTCTGGACCATATACCATCTCCAGCTATTTACACACACCTTTCTTTAGCA
TGCTACAGTTATTAATCTGGACATTCGAGGAATTGGCCGCTGTCACTGCTTGTTGTTTGC
GCATTTTTTTTTAAAGCATATTGGTGCTAGAAAAGGCAGCTAAAGGAAGTGAATCTGTAT
TGGGGTACAGGAATGAACCTTCTGCAACATCTTAAGATCCACAAATGAAGGGATATAAAA
ATAATGTCATAGGTAAGAAACACAGCAACAATGACTTAACCATATAAATGTGGAGGCTAT
CAACAAAGAATGGGCTTGAAACATTATAAAAATTGACAATGATTTATTAAATATGTTTTC
TCAATTGT
aacgacttctccatctcctgtgtaatcaaggccagtgctaaaattcagatgctgttagta
cctacatcagtcaacaacttacacttattttactagttttcaatcataatacctgctgtg
gatgcttcatgtgctgcctgcaagcttcttttttctcattaaatataaaatattttgtaa