Gene PPP1R3C Variant 1
DNA : 4.58 KbNT_030059
mRNA : 2493 bp NM_005398
CDS : 954 bp NP_005389
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  68 bp
gccggggcgagggctggcgccccagctgggcgctggttggtcgcgccctggggctcgagg
cccggcgattggtcccagggatcgggtcacgtgcttgggagcagataagcggcctctagg
cgccgggccctcagtctctcccagcgaccgccgcgggggcaaggcctggagctgtggttc
GAATTTGTGCAGGCAGCGGGTGCTGGCTTTTAGGGTCCGCCGCCTCTCTGCCTAATGAGC
TGCACCAG
gtaggttcgctgcaactctgcgcgctaggaacacaggggaacgcgcagctgtggggaagt
tggggggcgtttcagttctatcatctctggaaatggacaccccagggggaggacaagtgg
actgactgcgtagttgaatctggcaaccgagaggccttggaggtgtagaaatttggctct
EXON 2  2425 bp
ggtagacatagaagatctgatcacttaatactgttctcttttactacatatgatagcacc
tgcctgatatctagtgcactggctataattcagtcagcacaaaaatagtacatatgtatt
tggcactggggaagagcatttccgatccaggtgataatccctcttctttttgcattccag
AATGATCCAGGTTTTAGATCCACGTCCTTTGACAAGTTCGGTCATGCCCGTGGATGTGGC
CATGAGGCTTTGCTTGGCACATTCACCACCTGTGAAGAGTTTCCTGGGCCCGTACGATGA
ATTTCAACGACGACATTTTGTGAATAAATTAAAGCCCCTGAAATCATGTCTCAATATAAA
ACACAAAGCCAAATCACAGAATGACTGGAAGTGCTCACACAACCAAGCCAAGAAGCGCGT
TGTGTTTGCTGACTCCAAGGGCCTCTCTCTCACTGCGATCCATGTCTTCTCCGACCTCCC
AGAAGAACCAGCGTGGGATCTGCAGTTTGATCTCTTGGACCTTAATGATATCTCCTCTGC
CTTAAAACACCACGAGGAGAAAAACTTGATTTTAGATTTCCCTCAGCCTTCAACCGATTA
CTTAAGTTTCCGGAGCCACTTTCAGAAGAACTTTGTCTGTCTGGAGAACTGCTCGTTGCA
AGAGCGAACAGTGACAGGGACTGTTAAAGTCAAAAATGTGAGTTTTGAGAAGAAAGTTCA
GATCCGTATCACTTTCGATTCTTGGAAAAACTACACTGACGTAGACTGTGTCTATATGAA
AAATGTGTATGGTGGCACAGATAGTGATACCTTCTCATTTGCCATTGACTTACCCCCTGT
CATTCCAACTGAGCAGAAAATTGAGTTCTGCATTTCTTACCATGCTAATGGGCAAGTCTT
TTGGGACAACAATGATGGTCAGAATTATAGAATTGTTCATGTTCAATGGAAGCCTGATGG
GGTGCAGACACAGATGGCACCCCAGGACTGTGCATTCCACCAGACGTCTCCTAAGACAGA
GTTAGAGTCAACAATCTTTGGCAGTCCGAGGCTGGCTAGTGGGCTCTTCCCAGAGTGGCA
GAGCTGGGGGAGAATGGAGAACTTGGCCTCTTATCGATGAATTAAGCAACAATGTAACTG
GTCTTGACTTGTCATATTCCCCCATGCAATCCTAGGTCTGTATTGCTCAATTTTAGGAAG
CCTTTGCTACTCCATCAGTAGGTTTAGATTTGAGCTTTTGAGACCTGGCTATGGAAAAGA
AAGACACTTGAGAATTTAGTGTTGGGGTCTGTACAGATGATGCTACCCAATTTGGCTTTG
AAGGATCAAGTAACAGGTTGAAAACTATTTTTATAAAGGTAATACTTTTTCAGTTCCCTT
CTTCCTTCCCTCTCAATCCACTAGCTTTCATGTTGGGCAAGGAAAAGTTGAGGAAGGATG
GCTGATGGTGATGGAAAGCTGTGTTAATGGTATGAGGAATGTGTGAAAAGTATACACAAA
GGGCTCTGAAGCTCAAGTCAGAGGAGTGGGAGGTCTGATCATTGTTGGTGGAAAAACGTA
AGGTTATTTTGTGTTTTTAAGTTGGTTTTACAATTCTTTCCTGGGGAAATTATTTCTGGA
GGGGAAAAAGATCCATTCTACGTATCCTTGTGGAGAAAAGCTAAATAACCTTTAAGAATG
TGGGTGGTATTGGAGAAAGAAGATGAATTATAGCTCCGGAGAATCAAGATCTTAAGTGAA
GCCTTTCTGTTCAGATGTGATCTATAAAAAATCATAATTTGGGGAAAGTTTAAGCAAATC
TGGCTTTGTAGTCCTGATGTTATAAGTGACTTTGTGATCAAACTGTCAGGCTTGGGTTCT
TGTTATAGAATGCTTGGTATAGAAAAACCATGCCATCATTAATGGCTAACAACACGTAGG
GACTTCATGTCATGTCAAAGATAGCTCTTTGCAAGTGCCTTGATTAAACCAGAAAACTGT
CATCGTTTAACCCAAATATCTGAATGGTCATCTGGTAACTCATGGGTTTTTGGCCTCATA
AGATGGTCCACTCTGTACACAGGCATTCCTCCTGCAATAATGTTGTATCTTTGAGACCGT
TGTCAGTGTACACAACTCACATCCTTCATATTGAAGGTGACTCATTTTTCTGCACACTTT
TTTGATGTGATGCTTGACGTGAGGCCCGACACTAGGATTCTCAATGCAAGAATCCAGTAC
CTTGCACATAGAAGTAGCAACCCATCCCTTGCCTATTTTCATCTTGCTGTTTTCTTTTTT
TTAAAAAAATGGATGTGACTTGTTTTGAATGTTTTGTATTATACTTGTTTTTGTGTGTGC
ATAAATTCATTCTGTAGGATCTTAAGAAAAAGAGTCCCAGAATGTTGCTTCTATTATTGT
GCACAACCATTGAGAGGTGTTACAAGAATGCAGTTAATTTTAACATGTGTGATGTGCCAT
GGTGGAAAAGTACTATCGGAATAACTCTGCAGTGACAGAATTTGAAGTTTGGCTAGCATC
CATACTTTTCTACTGTAAATATTTCACTCTCCTCTAGCTATCCTTGATGAGCTTCTCACT
TTAAGAATAAATGTGTTTGATATAA
ggcctgagtatattttctttctcaaagccacagtcaaataagaaactcaactgacattct
catttttcatttaggaacaactgagcagagttagtatggaccaagacatggatccatctg
aggatattcacaaggccccagtctcaatagtgagcacacttcctaccacctgaccattgg