Gene PHYH Variant 1
DNA : 22.30 KbNT_077569
mRNA : 1577 bp NM_006214
CDS : 1017 bp NP_006205
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  134 bp
tttaaaaagaaagaaaataaaggacggaaggatcatggtgtggggaggacttcagccccg
ggcggttgcccggcgcgcggactctagcggactagggctccccagcagcccggcccgcga
gctggcaccgcccggaatcccgcttacgtccagtccggggcggcgcctggaggcggagcc
GCCCGCTGGGCTAAATGGGGCAGAGGCCGGGAGGGGTGGGGGTTCCCCGCGCCGCAGCCA
TGGAGCAGCTTCGCGCCGCCGCCCGTCTGCAGATTGTTCTGGGCCACCTCGGCCGCCCCT
CGGCCGGGGCTGTC
gtatcctttgggctgcgcggggctcgggctggatccggcgccggcgccgccgcctgagtg
gtggccctggtccgggtggaggcctcggggtcgcacgcttcgcagccccagcgcctcctc
gctcagcgccgcgtccccgcctgggtcgcgtctcttccaggagccggggagcggggaaga
EXON 2  59 bp
cccggcctaatttgtatttttagtagagatggggtttcaccatgttggccaggctggtct
cgaactcctgagctcaagtaatcctcctgcctcagcctcccaaagtgctggaattacagg
catgagccaccgtgcctggccttctatattttactttatttgccttaattcacatcctag
GTAGCTCATCCCACTTCAGGGACTATTTCCTCTGCCAGTTTCCATCCTCAACAATTCCA
gtaagtagtttgagttttgattttgaaatatattatgtatataaaagtttcttgagtggt
aatgaagatataccacataatatgttacctgattagaattttattatacaaatcctctgt
ttccaggacttattctaattagtgcacttgtggaaaattttggagaccgactaattttct
EXON 3  111 bp
aaccagtattttttgtagagacagggtttcatcatgttgcctgggctagtctcaaactcc
tgacctcaagtgatccacttgcctcggcccgctaaagtgctagtattagaggtgtgagcc
attgtgcctagcctgtaatttaaaaatgtaacttattttgggattctttttctcctttag
GTATACTCTGGATAATAACGTTCTAACCCTGGAACAGAGAAAATTTTATGAAGAAAATGG
GTTTCTAGTAATCAAAAATCTTGTACCTGATGCCGATATTCAACGCTTTCG
gtacagtaacactatttgttattttacaatagtatgtattgtgtgcatgtaatgagaata
caaggtggattcgctcctggctttacagatgttttttaatgatttggtttgttgggaagt
gtttagaagcatgggctctggtgccagactggctttttattttttatagagaaaggttct
EXON 4  169 bp
ggaatggattctagccagacagtttctcctccctttcattggaattattctacctcaagc
tggaggccaacttagtgcagagaaaccacccctcaagtctgcaaccctttccacagagga
gggcagggcaggtgcttggagccagcggtaacgacatcatttgcaaattaaattttctag
GAATGAGTTTGAAAAAATCTGCAGAAAGGAGGTGAAACCATTAGGATTAACAGTAATGAG
AGATGTGACCATTTCGAAATCCGAATATGCTCCAAGTGAGAAGATGATCACGAAGGTCCA
GGATTTCCAGGAAGATAAGGAGCTCTTCAGATACTGCACTCTCCCCGAG
gtcagagaccacccttgctttgcgtcggcttaattgccagtgtgtatgtctgcctgtaaa
acccgctgatttggccgggcgcagtggctcactcctgtaatccgagcactgtgggaggct
gaggcaggtggatcgcttgatcccaggaaccactgctcttagagctggatatggaaagga
EXON 5  82 bp
ttagaatgatttccaatggctgggtttttcatgctttgtttgcaatgttgtgaaataccg
cttggttcttaaactattgccttcttggttcttgtgtggatagctactgtactttgtacc
agttgtcaatacttctgatttcccacaaggtttgtttttgttttttttttgctttcttag
ATTCTGAAATATGTGGAGTGCTTCACTGGACCTAATATTATGGCCATGCACACAATGTTG
ATAAACAAACCTCCAGATTCTG
gtaattgtaagggagaagaaaaaaaaatggtttcattaaaatgtgtaaggttggctgggt
gcagtaactcatgcctgtaatcccagcattttaggagaccaagggaggaagatctctgag
gccaggagtttgagagtggcctgggcaacatagtgaggctctgtctctaaaaataaaatt
EXON 6  182 bp
ctgtagaaacggagtctcactgtgtttcccgggatggttttgaactcccaggctcaagcc
atccatctgcctcagcctcccactttgggatatatttttatatcccaaagtgctggggtt
acaggcgtgagccactgcactcggcctcgagtatcctttagtagcaggttttcttttcag
GCAAGAAGACGTCCCGTCACCCCCTGCACCAGGACCTGCACTATTTCCCCTTCAGGCCCA
GCGATCTCATCGTTTGCGCCTGGACGGCGATGGAGCACATCAGCCGGAACAACGGCTGTC
TGGTTGTGCTCCCAGGCACACACAAGGGCTCCCTGAAGCCCCACGATTACCCCAAGTGGG
AG
gtaggtctgcccggcggctgagtcttgatccgaatctccttcgcagtttctgtttcacat
cagtacctctaaagagtttacaaatgagatggcatttcctttctgagcaaaacattgtcc
taagatttgcagtgaggatcagagaaagttcaaggatgtcagagaaaacattcatcacac
EXON 7  150 bp
agatatctgagaggcttttgtatactgaaaaaaatgtaagcatttaatttagacatttat
ttctcttgggagagagaaatgctttctttccctgatgtttgctttccctgatgaaccatt
gacaatgtttttaattatggtactccctcaaatgtagacttcacttgcctcttgttctag
GGGGGAGTTAACAAAATGTTCCACGGGATCCAGGACTACGAGGAAAACAAGGCCCGGGTG
CACCTGGTGATGGAGAAGGGCGACACTGTTTTCTTCCATCCTTTGCTCATCCACGGATCT
GGTCAGAATAAAACCCAGGGATTCCGGAAG
gtaagcattcacattgctgcacctgctgcagaagtgtgggttagaaacaaaaattgtatt
caattcattgaattcaaattaattgaataaaattttaattaaattgcattaacattttaa
agatttgtggcttttaaccaacctggactttagtccagtttatttaccaggaaatatatt
EXON 8  135 bp
ctggaaacaaaaacaggcttagttacaaagagattgacacaggatgcaatggacctgact
ttccacttagaaatcaaatactgagtgaaataaatgactttctaaaagaaagactccctg
cttggtcactggtattcatgggatgtttttctccaatatcaatttgttcactttgcacag
GCAATTTCCTGCCATTTCGCCAGTGCCGATTGCCACTACATTGACGTGAAGGGCACCAGT
CAAGAAAACATCGAGAAGGAAGTTGTAGGAATAGCACATAAATTCTTTGGAGCTGAAAAT
AGCGTGAACTTGAAG
gtatgtttgtatacaatagcaaggtaaaaatctcaggtttttcttttcttcagatgcttc
ataattctcatacctagtttatttgacagtatatagtgcttgggtttagattcattttag
ggacatcgctgagcccccaccaaaaatgacaatggaatttccatttacacttgtgccccc
EXON 9  555 bp
gagtaagtagtttaagttgagttgttttgtttactaatgaatataacttacagggattat
tttccctatgtaacctttcatagaagctagaaatcaattttgtgttatggtgaaattgaa
ggttaatggagggcagattgaagtgttccataaacccactctgtttgatattatttccag
GATATTTGGATGTTTCGAGCTCGACTTGTGAAAGGAGAAAGAACCAATCTTTGAAATAGC
CATCTGCTATAACTCTTTCAACAGAAAACCAAAACCAAACGAAATGTCTAAGGAAAATGT
TTTCTTAATGAGATGATGTAACCTTTTCTATCACTTGTTAAAAGCAGAAAACATGTATCA
GGTACTTAATTGCATAGAGTTAGTTTTGCAGCACAATGGTGTTGCTTTAATGGAAAAAAA
AAACAGTAAAAGTGAAATATTACTGTTTTAAGGAAAACTAATTTAGGGTGGCAGCCAATA
AAGGTGGTTGGTGTCTAATTTAAGTGTTAAATCAATTTCTTTCATTCAGTTAGCTCTTTA
CCCAAGAAGAAGTGAATGATTTGGAGCTTAGGGTATGTTTTGTATCCCCTTTCTGATAAA
CCCATTCCCTACCAATTTTATGTCATAAGAGATTTTTTTCCCCCAAATCTAGAACAATGT
ATAATACATTCACATCTAGTCAAGGGCATAGGAACGGTGTCATGGAGTCCAAATAAAGTG
GATATTCCTGCTCGG
acaagggctttctcctgtgatttcttcaacccaaccattcccttaacaagaagacttgtt
ctttccagtcctttcctctgttcctgaagaatgaagacaagggccaggtgcagtggctca
cgcctgtaatcctagcactttgggaggccgaggtgggtggatcacctgaggtcaggagtt