Gene PAPSS2 Variant 1
DNA : 86.16 KbNT_030059
mRNA : 2015 bp NM_004670
CDS : 1845 bp NP_004661
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  108 bp
aggcggcggcggccgggtccccaaggctgggcgctgcttgcggaaccgacggggcggaga
ggagcgtggcgggaggaggagtaggagaagggggctggtcaagggaagtgcgacgtgtct
gcggagcctttttatacctccttcccgggagtccggcagccgctgctgctgctgctgctg
CTGCTGCCGCCGCCGCCGCCGCCGTCCCTGCGTCCTTCGGTCTCTGCTCCCGGGACCCGG
GCTCCGCCGCAGCCAGCCAGCATGTCGGGGATCAAGAAGCAAAAGACG
gtaggcttccaggcgccggcttccctccccgccaccgcactgcacgcgccgacccccaac
ccccaattccccggcacttgggtcccaccctccccgggagggggcgtcgggaggaggagt
aagagtggggcacggagggaagcaagagaaagaggctctgtgtggaattcccggggcagt
EXON 2  118 bp
agaaatgaaaaaaactatattagaatggacaaaggtgagtctctttcaaaatatttttta
tataagttgttacatgtatcagtttcgcaattaaaagtttaagatggatttatattggct
ccagtgaagaatatgtgttttattaattaatactgtgcttggttttgtcttattttatag
GAGAACCAGCAGAAATCCACCAATGTAGTCTATCAGGCCCACCATGTGAGCAGGAATAAG
AGAGGGCAAGTGGTTGGAACAAGGGGTGGGTTCCGAGGATGTACCGTGTGGCTAACAG
gtatgtcatgttcatatatatatatatatatacaaattgcaaactgacatgtgacacaat
tttatggaaattagtgtaacgtattacatgcttgttttatcattagaaggaggctgggag
atgtagtagaaagcctgggtgttagtcctaaccctaccatcagtgagaaatagagtcaag
EXON 3  236 bp
tagttatttcaaaatttgagagaaatgtaagtacttgccttgtagtcaactacactgatt
tctttctttcttttttttttttttaagatttagttatatttaaaattactagattagttc
acaatttgtcatcttaaactatccaggccgatgtcagtctgttttatctgttctgaacag
GTCTCTCTGGTGCTGGAAAAACAACGATAAGTTTTGCCCTGGAGGAGTACCTTGTCTCCC
ATGCCATCCCTTGTTACTCCCTGGATGGGGACAATGTCCGTCATGGCCTTAACAGAAATC
TCGGATTCTCTCCTGGGGACAGAGAGGAAAATATCCGCCGGATTGCTGAGGTGGCTAAGC
TGTTTGCTGATGCTGGTCTGGTCTGCATTACCAGCTTTATTTCTCCATTCGCAAAG
gtaaaaaaaaaaaaaaaaaaaaaaggcactacacacgattcccacacacagtgcaagtgc
tctccaactgctaggggaaggaatcggagagggagggcataagaatgtctcctttcaatt
tcccgactatttcttcccccaataacaggctctctcatttcctctatttaatattggtta
EXON 4  139 bp
aagtccttgagagagctgtgtttaccagagtaaaatttctggactttctctcaagcactc
tgcaaagcacaaaccccagtgttatctcaaggctattgaaaaccaaagtacacagtgttt
tgtgatttagaatttcaccgtgaaacctctttttacattcttaatcatattgcttttcag
GATCGTGAGAATGCCCGCAAAATACATGAATCAGCAGGGCTGCCATTCTTTGAAATATTT
GTAGATGCACCTCTAAATATTTGTGAAAGCAGAGACGTAAAAGGCCTCTATAAAAGGGCC
AGAGCTGGGGAGATTAAAG
gtaagagaattggctagtagcgtctaccagttacataggctgtcagtcctcagtccttat
tctgtcctcagaaatcttccttgagtttcaaactgttttccaaaattgcatataacatgc
acaactttttatcagatcatgatatattcagtatgcccagaggcttattaaaaggtaggg
EXON 5  119 bp
gaaaatacagctatatattttcttacttatggctagaagtcaaggatggctgtttgacct
tttctgttaaagtgtgaattttcagtttaatacattattccaacatgtgttttgccttat
tgattaaaaagattattctgtcaatacagatgcgatgattgtcacccatatgctttgcag
GATTTACAGGTATTGATTCTGATTATGAGAAACCTGAAACTCCTGAGCGTGTGCTTAAAA
CCAATTTGTCCACAGTGAGTGACTGTGTCCACCAGGTAGTGGAACTTCTGCAAGAGCAG
gtaggtgaaccggttgtctttttttatatgtttaataaaatcatgaaagacaatctatgc
ctctttactgaagcattctttttacagttttcaagtttttaccaatgctgtttcatttca
gaacattgtaccctatactataatcaaagatatccacgaactctttgtgccggaaaacaa
EXON 6  114 bp
ccaatttgtccacagtgagtgactgtgtccaccaggtagtggaacttctgcaagagcagg
taggtgaaccggttgtctttttttatatgtttaataaaatcatgaaagacaatctatgcc
tctttactgaagcattctttttacagttttcaagtttttaccaatgctgtttcatttcag
AACATTGTACCCTATACTATAATCAAAGATATCCACGAACTCTTTGTGCCGGAAAACAAA
CTTGACCACGTCCGAGCTGAGGCTGAAACTCTCCCTTCATTATCAATTACTAAG
gtaagtgggtgcagactggtcaaataattaggcttaatatcagtcattataatttattta
caattactcttaacaataagaaaagtataaataaggtgcacataatgtccataaataaaa
cactcctttttttccaagttatttttaacctcttctccaaagaaatctctcaccaagaat
EXON 7  112 bp
tccaaacttaaatatttctggcccttagatcatgggttagcataacaggtggggacactt
aaaacatagaaggttctgccctcatcctcctgttaactgaataagaaaggacttccctgg
ggccagatgcctggaaaacagaacttatgaaaatgttcaactactttttgtgttttgcag
CTGGATCTCCAGTGGGTCCAGGTTTTGAGCGAAGGCTGGGCCACTCCCCTCAAAGGTTTC
ATGCGGGAGAAGGAGTACTTACAGGTTATGCACTTTGACACCCTGCTAGATG
gtatgtttttgttgttgtttcttactctttgttgttaaggaaaaaaaaaaatctttccca
gaagttttgcaggaacaggaagttagtctttagtttgcaaatcttattgcaaaactgttt
ggatcatttacagtgtgctccattctattatgtttaagcttccatttttaggattttttg
EXON 8  206 bp
tcaaggacttgtcattatagaatctagagaaactggtgcagctaacacaactacttggat
ttgggtcttaatgcttcttgaaggaaatgtttggaaggggcattgtgcacatttgattca
tgcttcaaggatggcacaccttatatctagttttcgtgcatcacatggctctttccacag
ATGGCGTGATCAACATGAGCATCCCCATTGTACTGCCCGTCTCTGCAGAGGATAAGACAC
GGCTGGAAGGGTGCAGCAAGTTTGTCCTGGCACATGGTGGACGGAGGGTAGCTATCTTAC
GAGACGCTGAATTCTATGAACACAGAAAAGAGGAACGCTGTTCCCGTGTTTGGGGGACAA
CATGTACAAAACACCCCCATATCAAA
gtaagtcacaaaacctttggaaggactttcttgagctatttaaactgagaagaaaaataa
ctctttttaattcctttgcaaaggacttagaaaaactgggattaggtggaagaatgtatt
tctaaggtagtgtttgcaggctttgcctcaggagatgtttttagaaaggtgcaaagaaat
EXON 9  136 bp
tttttaagagcataacgggttctagagaccaaaaagtttgagaaatactgtgccagaaat
actaaagaactgaaggcagttctttaactgtaacccgagattggtctaaaaggagaaaac
ttttcagataaaatagaaatcacaattaatcattagcaatcataacaatgttctttctag
ATGGTGATGGAAAGTGGGGACTGGCTGGTTGGTGGAGACCTTCAGGTGCTGGAGAAAATA
AGATGGAATGATGGGCTGGACCAATACCGTCTGACACCTCTGGAGCTCAAACAGAAATGT
AAAGAAATGAATGCTG
gtatgtaaactgttcttagtgcattttatttatttatttattgagatggtgtcttgttct
gtcacccaggctggagtgcaatggcacgatctcagctcactgcaacctctgcctcccagg
ttcaagtaattctcctgcctcagcctcctgagtagcttggattacaggtgcccaccacta
EXON 10  269 bp
ctgagatcgctgactgcactccagcctgggcaacagagtgagactctttcaaaaaaaaaa
aaaaaagccagtggataatgaatgcacagaacaataaacatagctgtgtcctttctgttc
ttgtggagaaatgacaccatgtgtttctgtgaccttccttcttctgctttcctctcccag
ATGCGGTGTTTGCATTCCAGTTGCGCAATCCTGTCCACAATGGCCATGCCCTGTTGATGC
AGGACACTCGCCGCAGGCTCCTAGAGAGGGGCTACAAGCACCCGGTCCTCCTACTACACC
CTCTGGGCGGCTGGACCAAGGATGACGATGTGCCTCTAGACTGGCGGATGAAGCAGCACG
CGGCTGTGCTCGAGGAAGGGGTCCTGGATCCCAAGTCAACCATTGTTGCCATCTTTCCGT
CTCCCATGTTATATGCTGGCCCCACAGAG
gtgagcaattcccagagctgggctttgagactcaggaattcagactcagactttacatag
aagagtaaatgagtctctgggatcctttctgtttcctcatgagcagattctggaatgttc
tggtgtctcttctttatctagcttaattatgtttccacttagtatttgaaaagtgctaga
EXON 11  230 bp
acctaatataacaaagcatgaagagtgcacggagtcttagaacctcagtgattttcttgc
aattcttagttgactcacattgctgaattacttttaaagtagaataaaggtgtctccata
aaccatgacctacagatttgacccacaatgaccagcatgtcccttatggacattttctag
GTCCAGTGGCACTGCAGGTCCCGGATGATTGCGGGTGCCAATTTCTACATTGTGGGGAGG
GACCCTGCAGGAATGCCCCATCCTGAAACCAAGAAGGATCTGTATGAACCCACTCATGGG
GGCAAGGTCTTGAGCATGGCCCCTGGCCTCACCTCTGTGGAAATCATTCCATTCCGAGTG
GCTGCCTACAACAAAGCCAAAAAAGCCATGGACTTCTATGATCCAGCAAG
gtaggttttcagaggaaaattcttttatcaacatctgtataaaagaaatgatgaggcaga
atttgggccctttgaaaaactctccagtgcattgccacatgctcccaagtggactgagtc
ccttgagagtcaagacgtggtcttataaattttatgtcccctaaaattgtactacagtct
EXON 12  228 bp
tagctgccattatttcccttctcttctgcaagttcctgaagatttagaggactgcccact
tttgaagatgcagcattttacagaaagaacatgggtctcaaaaaccataacctactccag
gaatccttaaggcagatatcatttacctacactgagttctttgttgccaccctgtaacag
GCACAATGAGTTTGACTTCATCTCAGGAACTCGAATGAGGAAGCTCGCCCGGGAAGGAGA
GAATCCCCCAGATGGCTTCATGGCCCCCAAAGCATGGAAGGTCCTGACAGATTATTACAG
GTCCCTGGAGAAGAACTAAGCCTTTGGCTCCAGAGTTTCTTTCTGAAGTGCTCTTTGATT
ACCTTTTCTATTTTTATGATTAGATGCTTTGTATTAAATTGCTTCTCA
atgatgcattttaatcttttataatgaagtaaaagttgtgtctataattaaaaaaaaata
tatatatatacacacacacatatacatacaaagtcaaactgaagaccaaatcttagcagg
taaaagcaatattcttatacatttcataataaaattagctctatgtattttctactgcac