Gene OPTN Variant 1
DNA : 37.11 KbNT_077569
mRNA : 2296 bp NM_021980
CDS : 1734 bp NP_068815
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  134 bp
ggaggggcggggccttggtcgggtggggtatggaatgggcagggtgggggggatgggcgg
ggtatgggatgggcggggcccgggaaattccccggcgcgggcagggagcggctggctgtc
agctgagccgcgctgggcggggtcgccaggccgcgcatcagccctaggcaccccagtccc
GGCTGCCCCCTCCGCCACCGCCGCCGCCCGCCGGCAGGTTCCCTGGTCAGCGTCCCATCC
CGGTCGGGAGTTCTCTCCAGGCGGCACGATGCCGAGGAAACAGTGACCCTGAGCGAAGCC
AAGCCGGGCGGCAG
gtgagccagggcagggggctgcagcggtgggcgagggggcggcggctccttcccggcggg
cgcttccgcggcctgaaaacggtacccgccgccctgccccgcggcccggagcctgtcggg
gtgagggtggcgaggggtggggcggccctcccgcgagacggctgccctgggaggatcccc
EXON 2  177 bp
gaagctacatataccttttttgtttaaaaggaagaatcaaaaatgtccaaaatgtaactg
gagagaaagtgggcaacttttggagtaagtattagcaatcgccaatgggtttgtgggact
cccggggaccccttgtggggcgggggacagctctattttcaacaggtgacttttccacag
GAACTTCTGCAATGTCCCATCAACCTCTCAGCTGCCTCACTGAAAAGGAGGACAGCCCCA
GTGAAAGCACAGGAAATGGACCCCCCCACCTGGCCCACCCAAACCTGGACACGTTTACCC
CGGAGGAGCTGCTGCAGCAGATGAAAGAGCTCCTGACCGAGAACCACCAGCTGAAAG
gtgagcagggctggcccctgtgtgccccattcatcctgggcctgcaagaaatgccatccc
tttgcactaaggcttggtggtgagctcccttctccccgtttccataggtggtagctggtg
gggaagcacaggatttagcatttggcaaggctaaatctgttctgatttttacttttggaa
EXON 3  203 bp
gctagtcttttctgtaagcaaaaaccacttcgtctttttgctgctgacccttgggccaag
gctaagcatggcatctttcaattcagagccatgtggtcaagtggactagagggagatttg
gttcatcagatcaagtccactttcctggtgtgtgactccatcactctgaacctcctgcag
AAGCCATGAAGCTAAATAATCAAGCCATGAAAGGGAGATTTGAGGAGCTTTCGGCCTGGA
CAGAGAAACAGAAGGAAGAACGCCAGTTTTTTGAGATACAGAGCAAAGAAGCAAAAGAGC
GTCTAATGGCCTTGAGTCATGAGAATGAGAAATTGAAGGAAGAGCTTGGAAAACTAAAAG
GGAAATCAGAAAGGTCATCTGAG
gtgagcagaccgatccattgtgatgttgttttttttttttcccttgacatttgcagtgga
atcttacgtgtctagactcctagatcaaaacctttcatggttcagtctggattggtgttt
tgcctggtcttggaagaagtgcttttgctgaaaagattggttgccctattaagggtcatg
EXON 4  183 bp
aattattaaattttttgtaaagatgggggtcttgctatgttgcccaggctggtctcaaaa
tcctggcctcaagggatcctcccacttcagcctcccagagctctgcgattaagggcatga
gcccatggtgcccagccttagtttgatctgttcattcactttactccttgtcatctccag
GACCCCACTGATGACTCCAGGCTTCCCAGGGCCGAAGCGGAGCAGGAAAAGGACCAGCTC
AGGACCCAGGTGGTGAGGCTACAAGCAGAGAAGGCAGACCTGTTGGGCATCGTGTCTGAA
CTGCAGCTCAAGCTGAACTCCAGCGGCTCCTCAGAAGATTCCTTTGTTGAAATTAGGATG
GCT
gtgagtttttggttttatttttgttttgagcaaactataaagcctcccctggaaagatga
aacaaataccactttttcttgtcaacacaagccaaggattgaggaaattccagtgtagca
aagataaattggctctcattttctaagtatagcataatgcatgtaagggttatcatagct
EXON 5  74 bp
ggggagggtacgtttccatttcctctgagccaccccgtttaaacagtgcacatctgaatg
tttggaagcttccttgggttgcatgtcacaaaaattcatcttttgtctttttcttctttt
gacaaagaatttgtcttgtagacatattgtgttaaatcccttgcatttctgttttcacag
GAAGGAGAAGCAGAAGGGTCAGTAAAAGAAATCAAGCATAGTCCTGGGCCCACGAGAACA
GTCTCCACTGGCAC
gtatgtgaaggaagactcgggctgtcaggcagacaggctgggcaggctcgtcactgggtg
cttgtcaccggaggtcaaatgttgtgacctgaggaagtaacttctttatgatttatacca
ggatctttccagaatatttggtttgaatgctatttaatgttgcagctcaaactggcaaag
EXON 6  153 bp
catggaggagcttggcactgggggtcccaggaccagctgtgcttgttcactagttgagaa
ttagttggagaatgttctggaaagcagttcctttaagctggtcccagttatattgggtta
ctctcttcttagtctttggaatttttctgatgaaaaccttttaacctttatactgaacag
GGCATTGTCTAAATATAGGAGCAGATCTGCAGATGGGGCCAAGAATTACTTCGAACATGA
GGAGTTAACTGTGAGCCAGCTCCTGCTGTGCCTAAGGGAAGGGAATCAGAAGGTGGAGAG
ACTTGAAGTTGCACTCAAGGAGGCCAAAGAAAG
gtatgaaataggttaacttgaaatatgtgtttttttaaaacagctttcctgagatataat
taagataccatacagttcacccatttaaagtatacatttcagtgttttttagaatattcc
aggattgtgcaaccactgttactacaatataattttagaacattttttcccccaaacagc
EXON 7  103 bp
tagccaattttaggatgaaaaataaaactaatgctaatatagtgaatgtgtagagatttt
gaaaacccctgatcctttatcccaattgtaaacaatgttctttttagtacttctgtaata
attgctatttctcttaaagccaaagagaaagtaacttttctatcttctgtgattttccag
AGTTTCAGATTTTGAAAAGAAAACAAGTAATCGTTCTGAGATTGAAACCCAGACAGAGGG
GAGCACAGAGAAAGAGAATGATGAAGAGAAAGGCCCGGAGACT
gtgagtcctaagattccacggccactaccacacccacacacacgagagtagtccagccac
tgaattcaaatcttgtgatgggttatttgctttagaaatatagaaatcatgttgatattg
aatattatctatctattccttttatatgtccttgtcctgctctgtgtcaattgtagcgag
EXON 8  116 bp
aagtaccaagtatccaaaacattcttttcctacacaatgtttggggtattgtcaaagttg
gattgattcaccagccagtcttaattggctactaatggttcagcctgttttctcctaaag
aggtttgtttaatgtcagatgataattgtacagatatgtttgggatttcccgtatgatag
GTTGGAAGCGAAGTGGAAGCACTGAACCTCCAGGTGACATCTCTGTTTAAGGAGCTTCAA
GAGGCTCATACAAAACTCAGCAAAGCTGAGCTAATGAAGAAGAGACTTCAAGAAAA
gtaagaatgagagagcaattttatcctcctttgaaatatacatttttacaaagtatacta
ctatataaaaacatagttttttaactatgttatgactaaaagaaaaatagacacctaatt
aaaatataaattcagaatatactaatgttccagttaatgtgtgagcatgaaatacttgta
EXON 9  150 bp
agggttcagaaatatggccaggtctagtgaagaagcaaggaggattatgtatttcatttt
gcattcataaaccctacagccctaaaattcttatattgtacataaccttggggtttgttt
aaaagccactgcgacgtaaaggagcattgtttatcctcatgaaatcttgacctttcttag
GTGTCAGGCCCTTGAAAGGAAAAATTCTGCAATTCCATCAGAGTTGAATGAAAAGCAAGA
GCTTGTTTATACTAACAAAAAGTTAGAGCTACAAGTGGAAAGCATGCTATCAGAAATCAA
AATGGAACAGGCTAAAACAGAGGATGAAAA
gtgagtatgttgagtcagaagggcagcgacggggcagaggagggagaatcgcctttttat
acagattggaattcggatttgagaataaattttaaaaaatttctttttcacttatctgaa
ggagtcctagcagacctctcagagagggggataaaatttaaaagttttgtcataataaaa
EXON 10  94 bp
ctctgtcttgatttttcagaaaagattttttttgagagtaagaaatgctagtaggtcgtg
gggtgataaaggtaggcgagaagatttttctactggagtgttcagaaggttgggaggcaa
gactataagtttctatgatattttccccaggattccattttttaatatcttttttaatag
GTCCAAATTAACTGTGCTACAGATGACACACAACAAGCTTCTTCAAGAACATAATAATGC
ATTGAAAACAATTGAGGAACTAACAAGAAAAGAG
gtattcactgaaaaaaattacttccatagcctagtaatgaacagaaactgttgaacgttt
tgtatataaaatagttacatgaatccttcactaaatctggtttcaaaggttgttttccaa
tgtatcattatttcttgcatctagggtttgtaacttctgatgttccacatatgtgtaatg
EXON 11  159 bp
caggcttgtctcccactcctgggctcaaacgatcctcccacctcagcctctcaattctag
gcatgagccaccacacccggccagagctgataattaaaaaaataaacctttttctaatat
tttactaaaacaggcagaattatttcaaaaccatttctagaataaatgtttctttttcag
TCAGAAAAAGTGGACAGGGCAGTGCTGAAGGAACTGAGTGAAAAACTGGAACTGGCAGAG
AAGGCTCTGGCTTCCAAACAGCTGCAAATGGATGAAATGAAGCAAACCATTGCCAAGCAG
GAAGAGGACCTGGAAACCATGACCATCCTCAGGGCTCAG
gtgaggcaccttccaaaaccccagctgagcgaggccagccctgactgtattctcgcattg
gaaagcaatggtgtttagaatgtttgtaattttctattttatatattttttcacccgtga
gtgtattaaaactttaaaattgaaacatttggaaagtgctcagtggatcttatctgttct
EXON 12  131 bp
tatctgctatcggaatgtacctggaaagtcatggtcattatactgttttctagcaggatt
gtgcatctgtgattcacaagggctattgaaggatacagcactacctcctcatcgcataaa
cactgtaagaatctgcattcatctaggtactaacttctgtatctttttttcctctaacag
ATGGAAGTTTACTGTTCTGATTTTCATGCTGAAAGAGCAGCGAGAGAGAAAATTCATGAG
GAAAAGGAGCAACTGGCATTGCAGCTGGCAGTTCTGCTGAAAGAGAATGATGCTTTCGAA
GACGGAGGCAG
gtaaggaaaagagagaggaggacccagagctcacatcagcatggccgtagaagaggtgcc
tgtccaaagacgttcctgatttgaactataagaatagctgtgttcgcgccactgcactcc
tgcctaggtgacagagcgagtcccctgtctgaaaaataaataataataataataattgct
EXON 13  80 bp
tttactttcactagtctcctagtgccaatagtatttaaaactaaaattagtctggttttt
atgaaccttggcagtgtagtttgagtcttttttcccctacttctgtggactgtctgctca
gtgttgtcatgtttcggggttgtagaacatcacacagcgtgttgcttttcgtcctggcag
GCAGTCCTTGATGGAGATGCAGAGTCGTCATGGGGCGAGAACAAGTGACTCTGACCAGCA
GGCTTACCTTGTTCAAAGAG
gtgagtcccgtgtgatcctggattttcaggaaatagctatcctatgaaaaagatgcttga
agaaaaattccacttcattctctacaatggattccaaatcaaggcaccaaaaatatagca
cccgtcagtctcattaccacagcactcccatctccatccattacccaccgaatccagacc
EXON 14  539 bp
agatttttctctatgtgcatcgtgatgacttcagttaaagaccaaacacctgtgctcatg
tcccactacgtgttgaatacgaagttgaactgatgttaaaactcgccatctgttcttcaa
gtgaaacaaacacaactgcctgcaaaatggaactaatggaattatcatacttattcccag
GAGCTGAGGACAGGGACTGGCGGCAACAGCGGAATATTCCGATTCATTCCTGCCCCAAGT
GTGGAGAGGTTCTGCCTGACATAGACACGTTACAGATTCACGTGATGGATTGCATCATTT
AAGTGTTGATGTATCACCTCCCCAAAACTGTTGGTAAATGTCAGATTTTTTCCTCCAAGA
GTTGTGCTTTTGTGTTATTTGTTTTCACTCAAATATTTTGCCTCATTATTCTTGTTTTAA
AAGAAAGAAAACAGGCCGGGCACAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGT
CGAGGTGGGTGGATCACTTGGGGTCAGGGTTTGAGACCAGCCTGGCCAACATGGCGGAAC
CCTGTCTCTACCAAAATTACAAAAATTAGCCGAGCATGGTGGCGCATGCCTGTAGTCGCA
GCTACTCGCGAGGTTGAGGCAGGAGAATTGCTTGAACCCAGGAAGTGGCAGTTGCAGTGA
GCCGAGACGACACCACTGCACTCCAGCCTGGGTGACAGAGGGAGACTCTGTCTCGAAAG
aaagaaagaaaaaaaggaaggaaggagaaggaaggaaggagaagaaaaggtacctgttct
acgtagaacacctttggtggagttccatcaactcgcaaagtagaatccttacctactact
cttctgataataattttaatattttttatgtttggttgatgcgagcagctgcactgctca