Gene MSMB Variant 2
DNA : 13.04 KbNT_008583
mRNA : 466 bp NM_138634
CDS : 234 bp NP_619540
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  35 bp
ataacttgggtggagatgtgattgattaataactcataaatcatctgaaaccatactttc
cttttgatagtcaaccctctgtaaacactcaatgtgttctcaccttgttatcattcccaa
tgatgtcgaatgcgtggttgccctctccagtataaaagtttgatgcagctttgcctggat
GTACCTGTCTATAAGGAGTCCTGCTTATCACAATG
gtaggtaactggttttatatataaaggctagaaaagcaaaagagaatatgtattcctatt
ttaatatgcgtgtgcttctaccacatagcattgaatggtaaatgtgacctagttaggaac
cttatgttattacctgcaattcaatgtgcagagtatgagagtctgagagcttgcgaaaat
EXON 2  106 bp
tcaactagatacttttccttgttctacaatttcagcctagattaactggtttgttcagtt
atgagctccacatcataacctctcagcagagcccagccgagatcctggtacacagcactc
agtcaaggattatcctttgaattaattcattctccaccctgacctttcttcacattacag
AATGTTCTCCTGGGCAGCGTTGTGATCTTTGCCACCTTCGTGACTTTATGCAATGCATCA
TGCTATTTCATACCTAATGAGGGAGTTCCAGGAGATTCAACCAGGA
gtaagtcttggcttttcaatgtttattatgttattgcagcctggtagatggacctgtctg
cagatgaaagcctttgtgtttctgtttgtttgtttctttgttttttgagatagtcatgct
ctgtctcccaggctggagtgcagtggcaccatttcagctcactgcaaactcctcctcccg
EXON 3  325 bp
agctgtgtgactctatggtacagactggtccaggttcctggaggtcacactctggggctg
ccagccaaagggtgcccttaagttggagtgtgggtgacttcctgaacagagctggcactg
gggagggggtgctcggggtcctttctcttctaacaggccccagttttgtctcaatgacag
TGTTTCTACACCTGTGGGTTATGACAAAGACAACTGCCAAAGAATCTTCAAGAAGGAGGA
CTGCAAGTATATCGTGGTGGAGAAGAAGGACCCAAAAAAGACCTGTTCTGTCAGTGAATG
GATAATCTAATGTGCTTCTAGTAGGCACAGGGCTCCCAGGCCAGGCCTCATTCTCCTCTG
GCCTCTAATAGTCAATGATTGTGTAGCCATGCCTATCAGTAAAAAGATTTTTGAGCAAAC
ACTTGAATATGTGTGTCCTTTTAATTTATAATTTATGTATGCATTGATTTAATACACATT
ATAAAGAATACAAAACATTTAAAAA
gggagacaaaactacatatgaatggccgggcacagtggctcatgcctataatcccagcac
tttgggaggccaaggcaggcggatcatttgaggtcaggggatcgagaacagcctggccaa
catagtgaaaccccgtctccactgaaatacaaaattagcgtggtggcaggcacctgtagt