Gene MRPL43 Variant 4
DNA : 1.25 KbNT_030059
mRNA : 1016 bp NM_032112
CDS : 480 bp NP_115488
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  203 bp
tgccagtctctatcctcccccgtgtcttcactccgctctactactccgagctccgccgcg
ccggcccccagccccaggttaccacttttctctctcccacttcgccggcaacgtgagtct
cccgcacatgctactcgccttgacctcggaagcaaaactccgggagcggtcgtcccggaa
CCGGAAGCCTCGAGGTTTAGTCCCGCCCCCCTCTCCTCGCTGCTTAGGCTCCGCGGCCTC
CAAGCTGTAGCTATGACGGCGCGCGGGACTCCGAGCCGCTTCTTGGCCAGCGTTCTCCAC
AACGGACTGGGTCGCTATGTGCAGCAGCTGCAGCGTCTGAGCTTCAGCGTCAGCCGCGAC
GGCGCCTCGTCTCGCGGCGCCAG
gtgagccaagggaagtgcgcaggcgcgggtcggggtgggtgtggaggtggcaacgactcc
ccgggtaggtcgcccccagtcaggggtcatactgctcactgtcccgggtcgcttagggag
ttcgtggagcgggaggtgatcgacttcgcccgacggaatccaggggtcgtaatatatgta
EXON 2  107 bp
tgcagcagctgcagcgtctgagcttcagcgtcagccgcgacggcgcctcgtctcgcggcg
ccaggtgagccaagggaagtgcgcaggcgcgggtcggggtgggtgtggaggtggcaacga
ctccccgggtaggtcgcccccagtcaggggtcatactgctcactgtcccgggtcgcttag
GGAGTTCGTGGAGCGGGAGGTGATCGACTTCGCCCGACGGAATCCAGGGGTCGTAATATA
TGTAAACTCGCGTCCGTGCTGCGTGCCCAGAGTAGTGGCCGAATACC
gtgagtggggccgggctcgggctggagggcgggatcaggggctcgacccgctatcctcct
tctcgcttggtcgcaccggccagcttccacccactctcacccctcttctgccagttaacg
gggctgtgcgcgaggagagcatccactgcaagtcggtcgaggagatctcgacgctggtgc
EXON 3  706 bp
atccaggggtcgtaatatatgtaaactcgcgtccgtgctgcgtgcccagagtagtggccg
aataccgtgagtggggccgggctcgggctggagggcgggatcaggggctcgacccgctat
cctccttctcgcttggtcgcaccggccagcttccacccactctcacccctcttctgccag
TTAACGGGGCTGTGCGCGAGGAGAGCATCCACTGCAAGTCGGTCGAGGAGATCTCGACGC
TGGTGCAGAAGCTGGCCGACCAGTCGGGCTTGGACGTGATCCGCATCCGCAAGCCCTTCC
ACACCGACAACCCTAGCATCCAGGGCCAGTGGCACCCCTTCACCAACAAGCCGACCACGT
TCCGCGGGCTACGCCCCCGAGAGGTTCAGGATCCTGCCCCAGCCCAGGTGCAAGCACAGT
GAAGAGTTGCCCCACCAACTGCAGCCCCAGGCTTTGGACTGTTACTCCGGTAAAGGTGGT
TCTTCCCCTTTGGGATTCCAAGCCCAGGCAAATGGAACCCATCAATGGGCAAGTTGACAG
AGGTTCTGCTTGGGATAATGAAGAGCTGCCTGTTTCTTTCCAGTGCCTGCTTCTGGGGGC
AGTGACCTTGTGAACCACTCATTTTTATGCAAGTGGCATCCCTAAAACCTGAGATGAGGA
AGACTTCAAGGGTTTTACAGGGCCCTTGTTTTTTAAATCCAAATTGATAATAATGATCTC
AAAACACAGTGAGAGGTCTGAAGGCTGGCTTCTGAAGAATCCCTGATGTCTTATTGGAAC
AACCACTGAGCTACGGAGAGCTCTGCTGTGATGGGCTAGGCACTTTATATCTGTGTGAAT
ACAGATTTATAAAACAGGTTAATAAACTTATCCAAGGTCACATTTC
aggtctgtcttcaaaatgtgtgcatatgttaagcacaagcctcagttttcattattttaa
aactagacgcagaacatataacaactgtcaggtggttagtatcaaaggccaagtgattaa
tctaggcctgacccctgaaagggagaggggagtgattctcagaccaagtcctggctgaca