Gene MRPL43 Variant 2
DNA : 6.14 KbNT_030059
mRNA : 767 bp NM_176793
CDS : 0 bp
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  203 bp
tgccagtctctatcctcccccgtgtcttcactccgctctactactccgagctccgccgcg
ccggcccccagccccaggttaccacttttctctctcccacttcgccggcaacgtgagtct
cccgcacatgctactcgccttgacctcggaagcaaaactccgggagcggtcgtcccggaa
CCGGAAGCCTCGAGGTTTAGTCCCGCCCCCCTCTCCTCGCTGCTTAGGCTCCGCGGCCTC
CAAGCTGTAGCTATGACGGCGCGCGGGACTCCGAGCCGCTTCTTGGCCAGCGTTCTCCAC
AACGGACTGGGTCGCTATGTGCAGCAGCTGCAGCGTCTGAGCTTCAGCGTCAGCCGCGAC
GGCGCCTCGTCTCGCGGCGCCAG
gtgagccaagggaagtgcgcaggcgcgggtcggggtgggtgtggaggtggcaacgactcc
ccgggtaggtcgcccccagtcaggggtcatactgctcactgtcccgggtcgcttagggag
ttcgtggagcgggaggtgatcgacttcgcccgacggaatccaggggtcgtaatatatgta
EXON 2  107 bp
tgcagcagctgcagcgtctgagcttcagcgtcagccgcgacggcgcctcgtctcgcggcg
ccaggtgagccaagggaagtgcgcaggcgcgggtcggggtgggtgtggaggtggcaacga
ctccccgggtaggtcgcccccagtcaggggtcatactgctcactgtcccgggtcgcttag
GGAGTTCGTGGAGCGGGAGGTGATCGACTTCGCCCGACGGAATCCAGGGGTCGTAATATA
TGTAAACTCGCGTCCGTGCTGCGTGCCCAGAGTAGTGGCCGAATACC
gtgagtggggccgggctcgggctggagggcgggatcaggggctcgacccgctatcctcct
tctcgcttggtcgcaccggccagcttccacccactctcacccctcttctgccagttaacg
gggctgtgcgcgaggagagcatccactgcaagtcggtcgaggagatctcgacgctggtgc
EXON 3  227 bp
atccaggggtcgtaatatatgtaaactcgcgtccgtgctgcgtgcccagagtagtggccg
aataccgtgagtggggccgggctcgggctggagggcgggatcaggggctcgacccgctat
cctccttctcgcttggtcgcaccggccagcttccacccactctcacccctcttctgccag
TTAACGGGGCTGTGCGCGAGGAGAGCATCCACTGCAAGTCGGTCGAGGAGATCTCGACGC
TGGTGCAGAAGCTGGCCGACCAGTCGGGCTTGGACGTGATCCGCATCCGCAAGCCCTTCC
ACACCGACAACCCTAGCATCCAGGGCCAGTGGCACCCCTTCACCAACAAGCCGACCACGT
TCCGCGGGCTACGCCCCCGAGAGGTTCAGGATCCTGCCCCAGCCCAG
gtgcaagcacagtgaagagttgccccaccaactgcagccccaggctttggactgttactc
cggtaaaggtggttcttcccctttgggattccaagcccaggcaaatggaacccatcaatg
ggcaagttgacagaggttctgcttgggataatgaagagctgcctgtttctttccagtgcc
EXON 4  63 bp
tattgccattcatcctccgcagccggctgggcagtgccaccaagccattggtcagctcag
ccggtggcggtgggggcggtgggggtggtggggctggggctccctccccagggatgatct
ggagacagctgccctccaggcccccagccccctcatcatcaccctcatcttcctctccag
GACACTGGCCTGAGACTGTCTGCAGTTGCACCGCAGATCCTCCTGCCCGGCTGGCCCGAC
CCA
gtgagtatttccgtcggcgccctcgtctgccttcccgcagacaggccacatagaggaggg
aggaggccaggatgaggcagaggccaccaagcgcggcaatggctagcacatagagcagtc
tcacatcaggtgccagctgtgccccaggtgtggcaggggcttttggagctggggcaggag
EXON 5  167 bp
acttacactccctgggcttcagagaggtccctcatggggataataataatggcacctttc
tcataagaatgctgtgacagtagatgacatcatgcatagaagtatttagatcagtgtctg
gcacacagtaaatacttaatacatcttagctgtgatgattaacttttgttctttcttcag
ATATCAGTTCAGTCATCCGATCTTCCTTGGGGAAATACCCATTACCGTCCTGAACCCTTG
TCATCCACTACTTGGCTATAAGCTCCAGAAGTGACAAGACACTTCACATCTTAAATATGT
TTCCTAGTTTATAATTCATTTGGGCAGTAAATGTTTGTTGAGCACTT
actctgtgccaggctctgtgtttgagtcatccttaccaaatgtacatagccacagccact
cagatacaaacatatacgtacacatggcagtaaatggcaaagaggacagtctgcgtagct
agacccacactcatatgagtcacttacctgtatccctgctgctctcacagcctcgatttc