Gene MRPL43 Variant 1
DNA : 9.69 KbNT_030059
mRNA : 2151 bp NM_176792
CDS : 648 bp NP_789762
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  203 bp
tgccagtctctatcctcccccgtgtcttcactccgctctactactccgagctccgccgcg
ccggcccccagccccaggttaccacttttctctctcccacttcgccggcaacgtgagtct
cccgcacatgctactcgccttgacctcggaagcaaaactccgggagcggtcgtcccggaa
CCGGAAGCCTCGAGGTTTAGTCCCGCCCCCCTCTCCTCGCTGCTTAGGCTCCGCGGCCTC
CAAGCTGTAGCTATGACGGCGCGCGGGACTCCGAGCCGCTTCTTGGCCAGCGTTCTCCAC
AACGGACTGGGTCGCTATGTGCAGCAGCTGCAGCGTCTGAGCTTCAGCGTCAGCCGCGAC
GGCGCCTCGTCTCGCGGCGCCAG
gtgagccaagggaagtgcgcaggcgcgggtcggggtgggtgtggaggtggcaacgactcc
ccgggtaggtcgcccccagtcaggggtcatactgctcactgtcccgggtcgcttagggag
ttcgtggagcgggaggtgatcgacttcgcccgacggaatccaggggtcgtaatatatgta
EXON 2  107 bp
tgcagcagctgcagcgtctgagcttcagcgtcagccgcgacggcgcctcgtctcgcggcg
ccaggtgagccaagggaagtgcgcaggcgcgggtcggggtgggtgtggaggtggcaacga
ctccccgggtaggtcgcccccagtcaggggtcatactgctcactgtcccgggtcgcttag
GGAGTTCGTGGAGCGGGAGGTGATCGACTTCGCCCGACGGAATCCAGGGGTCGTAATATA
TGTAAACTCGCGTCCGTGCTGCGTGCCCAGAGTAGTGGCCGAATACC
gtgagtggggccgggctcgggctggagggcgggatcaggggctcgacccgctatcctcct
tctcgcttggtcgcaccggccagcttccacccactctcacccctcttctgccagttaacg
gggctgtgcgcgaggagagcatccactgcaagtcggtcgaggagatctcgacgctggtgc
EXON 3  227 bp
atccaggggtcgtaatatatgtaaactcgcgtccgtgctgcgtgcccagagtagtggccg
aataccgtgagtggggccgggctcgggctggagggcgggatcaggggctcgacccgctat
cctccttctcgcttggtcgcaccggccagcttccacccactctcacccctcttctgccag
TTAACGGGGCTGTGCGCGAGGAGAGCATCCACTGCAAGTCGGTCGAGGAGATCTCGACGC
TGGTGCAGAAGCTGGCCGACCAGTCGGGCTTGGACGTGATCCGCATCCGCAAGCCCTTCC
ACACCGACAACCCTAGCATCCAGGGCCAGTGGCACCCCTTCACCAACAAGCCGACCACGT
TCCGCGGGCTACGCCCCCGAGAGGTTCAGGATCCTGCCCCAGCCCAG
gtgcaagcacagtgaagagttgccccaccaactgcagccccaggctttggactgttactc
cggtaaaggtggttcttcccctttgggattccaagcccaggcaaatggaacccatcaatg
ggcaagttgacagaggttctgcttgggataatgaagagctgcctgtttctttccagtgcc
EXON 4  63 bp
tattgccattcatcctccgcagccggctgggcagtgccaccaagccattggtcagctcag
ccggtggcggtgggggcggtgggggtggtggggctggggctccctccccagggatgatct
ggagacagctgccctccaggcccccagccccctcatcatcaccctcatcttcctctccag
GACACTGGCCTGAGACTGTCTGCAGTTGCACCGCAGATCCTCCTGCCCGGCTGGCCCGAC
CCA
gtgagtatttccgtcggcgccctcgtctgccttcccgcagacaggccacatagaggaggg
aggaggccaggatgaggcagaggccaccaagcgcggcaatggctagcacatagagcagtc
tcacatcaggtgccagctgtgccccaggtgtggcaggggcttttggagctggggcaggag
EXON 5  1551 bp
aaattagccaggcgtggtggcacacgcctatagtcccagctactcgggaggccgaggcag
gataatcacttgaacccgggaggcggagattgcagtgagccgagatcgcgccactgcact
ccagcctggcaacagagcaagactccctcttaaaaaaaaaaaaaaattctcactttgcag
CCAGACCTCCCCACAGTGGATCCTATCTCATCCTCATTGACCTCTGCTCCAGCCCCTATG
CTGTCCGCAGTTTCTTGCCTCCCGATTGTCCCTGCACTGACCACTGTGTGCTCAGCGTGA
AGGCTGCATAGAAGTGTGTACGGCTTGAGGTTTCAGCATCCAGGCTGCAGACCCCACGCA
GTGTCTCATACAGTGGAATGTGGCAGATGAGACGGGCTTTCAGGAAGGAAGTCCACTTCT
TCTGCAGGATCTTCTTCCCTCCCAGGTCTCCCTGGGGAGGTAGAGGCACGGGATAAGGGG
CCAGGGTCAGAGGTCCAGCCTCTATACCCGTGCCCCAACGTCAGCCCAATCCACCTTGCA
GACACGAGCCACACGGGCCACACGGTGACTGCTGCGGCTCTGAGTGAAGCTGCCAGAGCC
CTCCTCAGTGGCACGCTCCGTGAAGAAGTAGTACACCTTGTCATCATCACCCACTGCACT
GGCCTTGCTCTCCCGCACGAGGACGGAGAACACAAACTCCGCATCTGTGGGTCAGGCAGT
TTGAGAGGCTTTTGAGACAGGCTGGGGATTCCTTTCCCTCACTCTGAGGCTGACCCCTCA
CTTGACAACACACAGGAATGGAATGGACAGGCTCACCTGGGGATTTGGGGGTGGGGTGGT
CAGCTGGCCAAGGGAGTAAAAATGAAGAAATAGTCCCCTACCCCCCATCATCCTGTGCCT
CATCCTCCTAACCATTGAGCCAATGCATTGGTGTCTCCTCAGTTCTCAGGGAGTGTGGGT
GGCGGCTCCGGCGGATGTCAGGAATGCTCCGGAATTCATACCTAGTGGCTGTGTAGAGGC
CTCCATCTGGCGTGGGGATATTCCAGGCATGAGAGACATGTCATATTCAACAGGGCACAT
GACATATACATGGTGGCAGGTCCTAGAGATGAGATCCACATCCTAAAAATACCATGTCTG
TGATAGGGAAGAAGGCCTGCTCACCAATGATGAGGCCTGTGAAGCCACGGGCTGGGTCAT
AAGGACACTTCTCCTTCCCCTCCTCGAAGCTGGTTGGCAAGGTGAAGGCCTCAGCATCCT
AGGGAACAAGGAACCAGCAGTAAGTGGTTCCGAAGACAGGCAGGGACAGTGGCTCAAAGT
CAGATCAGTCTGGGGTCAGGGATCAGCGATCAGGGATAGGGGCAGGTTGTATGGCAGATG
CACCTGACAGCAATAACTTAAGCATCCCCTGAGAATGACCTTATGGCCTCAAAACAATGT
ATGTTTGGAGTTCCAAATCTGCAAGTGGCCAACCTAGAGATTCACTCCTTATCTATGAAG
AACATCTGAGCCCCTAGCCCATCCTGTGGAACACATGCTGTCCAGGGGATCAAGGCCCTT
TGTTTTGGGTTAAATGAAGTTTGCCAGGTGGAGGTGATTAGGGGGAGGATGCTAAGTGAA
AATGCTATAAAAACTGCATGGTTTTTACAAAGGGGAATGGTTCTCCAGTGCAGCCCGCCG
CCACTGGAGTGCCCTGTATGGAAGTCCCCTTAATAAACCATCCGTCTCCTT
cactggctctgagtctcttctttggcatcttgaacatgatcccatccctaatgaagtcaa
cagagatctggcacaacacaggtatactcacaatggctgcacagaggggctggaaggcgt
gagtcccacatgcatagaggtgggtagaattgagccgctgcaggaaccgcacatggttaa