Gene MKI67 Variant 1
DNA : 29.54 KbNT_008818
mRNA : 12493 bp NM_002417
CDS : 9771 bp NP_002408
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  106 bp
ggcgggaggactcgactcggtgggagccgctagagccgggcgcccggggacgtagcctgt
agggccaccgggtccccgtcagaggcggcggcgggagcagcggggactgcaggccggggt
gcagcgaacgcgaccccgcgggctgcggcccggtgtgtgcggagcgtggcgggcgcagct
TACCGGGCGGAGGTGAGCGCGGCGCCGGCTCCTCCTGCGGCGGACTTTGGGTGCGACTTG
ACGAGCGGTGGTTCGACAAGTGGCCTTGCGGGCCGGATCGTCCCAG
gtgagctgcggccgggactcctgggagctgtccggggtcgagggctgagccgcggggacc
ccccgagctctgcggggacgggcaggggacagacgcgcggcctgggcccgactcctcctg
ggctctggcgagggcgtctcggtggaagctcccaggaggcgcaggcgctggcgacaacac
EXON 2  181 bp
aggcgctggcgacaacaccccagctgccggactttggggcgccgggggctgcggtcggat
cgtcctggggtccccgctagctagctgcggtgtgcgcttctgtggccggggataggtgaa
ttgggcacggggcccttcttagctcctttgctatcagagtaactcgcacctcttttgcag
TGGAAGAGTTGTAAATTTGCTTCTGGCCTTCCCCTACGGATTATACCTGGCCTTCCCCTA
CGGATTATACTCAACTTACTGTTTAGAAAATGTGGCCCACGAGACGCCTGGTTACTATCA
AAAGGAGCGGGGTCGACGGTCCCCACTTTCCCCTGAGCCTCAGCACCTGCTTGTTTGGAA
G
gtgagccccgcgggcgcgcgcggacgttttagctgagaaagaggaaaataccttagtcac
agaataaagtccagaaacgcgctctaggattgggtcctgccgtcacttttccttggtgct
tctcccattcgttactaagttgacatagttgtgtttttttgttttgtaagtataaatttg
EXON 3  79 bp
atacttccaaaagttctttgcaaaatgcaagatcgtttacattgcccattttgtttgtta
ctcctttatgtcatatttacagatcaaacattctagtcaaattgtgttttattttgggaa
attgaggtaatcttttaaaaagttgcagcaaccaaaaaaaccttcttcttttgcatgaag
GGGTATTGAATGTGACATCCGTATCCAGCTTCCTGTTGTGTCAAAACAACATTGCAAAAT
TGAAATCCATGAGCAGGAG
gtgagtgggttttttgaagatctacttttaaagctttttagttcacttttaatctgttca
ttagttacatatttccccttcttttcacttgcaggcaatattacataatttcagttccac
aaatccaacacaagtaaatgggtctgttattgatgagcctgtacggctaaaacatggaga
EXON 4  116 bp
catgaaggggtattgaatgtgacatccgtatccagcttcctgttgtgtcaaaacaacatt
gcaaaattgaaatccatgagcaggaggtgagtgggttttttgaagatctacttttaaagc
tttttagttcacttttaatctgttcattagttacatatttccccttcttttcacttgcag
GCAATATTACATAATTTCAGTTCCACAAATCCAACACAAGTAAATGGGTCTGTTATTGAT
GAGCCTGTACGGCTAAAACATGGAGATGTAATAACTATTATTGATCGTTCCTTCAG
gtaggtaaaagctgattggtctaacagtaaatgtcatcttctgattaaccataaactagt
gtcaaagtcaactgtcattcttctttaatgttcatggatgtcaaagtatttcaggttttc
attctcaacactaatcttaatttaaaaggatatggatctaggaagatgactaattgggac
EXON 5  67 bp
aatcctagtttttagtgtaaaagcacttttctaactctaaatttatttctttgtataagg
tgatgtcttgaactaaacccaaagtttgttcgttgatccttggacattaagtggatatgg
agacttccgccccagggtataaatttttaatcaggatctttgtcgttctataaactgcag
GTATGAAAATGAAAGTCTTCAGAATGGAAGGAAGTCAACTGAATTTCCAAGAAAAATACG
TGAACAG
gtgatagaaaatatccaagtttgggctgattcgtttcgatgatatgaaatcatttatgta
tgctttaatgatttcttacttgaaatcagttacaaagagggtggttactgttatagtagg
aaaatgtaactaaagtataaaaacgagttgaacttagacgtattaaaataatctaaaatg
EXON 6  46 bp
caggctgttctcaaactcctgacctcaagtgatccgcccaccttggcctcccaaagtgct
gggattacaggcatgagccatcatgcccagccagaaaacaataaataatattttcactgt
tgtgactgtcatcatttagaaagacctgcaaataactgttcttattttcccaacttacag
GAGCCAGCACGTCGTGTCTCAAGATCTAGCTTCTCTTCTGACCCTG
gtgagtagtggttgggttttgttccagaatcctgaaagatcaggtctttgcgaagcatat
tggcaaagaaggggcaacaagaatgcaagtgctaaatgtctagcctgtcagaaatggagg
aggtgtcatttaacatgtcaacgacagacagatgcctaactttcccttggtgactgatgg
EXON 7  1080 bp
tatttgtatcataatactagtatcataagacttgcaagttttaggcattaaataatttgt
aggccaagtaaaagctagcttataagacaacctgaaacaattaaaatattgaattccaca
aatgttaatcattgagaaaatgctgaacttctgtttcttatttcataattcattgccaag
ATGAGAAAGCTCAAGATTCCAAGGCCTATTCAAAAATCACTGAAGGAAAAGTTTCAGGAA
ATCCTCAGGTACATATCAAGAATGTCAAAGAAGACAGTACCGCAGATGACTCAAAAGACA
GTGTTGCTCAGGGAACAACTAATGTTCATTCCTCAGAACATGCTGGACGTAATGGCAGAA
ATGCAGCTGATCCCATTTCTGGGGATTTTAAAGAAATTTCCAGCGTTAAATTAGTGAGCC
GTTATGGAGAATTGAAGTCTGTTCCCACTACACAATGTCTTGACAATAGCAAAAAAAATG
AATCTCCCTTTTGGAAGCTTTATGAGTCAGTGAAGAAAGAGTTGGATGTAAAATCACAAA
AAGAAAATGTCCTACAGTATTGTAGAAAATCTGGATTACAAACTGATTACGCAACAGAGA
AAGAAAGTGCTGATGGTTTACAGGGGGAGACCCAACTGTTGGTCTCGCGTAAGTCAAGAC
CAAAATCTGGTGGGAGCGGCCACGCTGTGGCAGAGCCTGCTTCACCTGAACAAGAGCTTG
ACCAGAACAAGGGGAAGGGAAGAGACGTGGAGTCTGTTCAGACTCCCAGCAAGGCTGTGG
GCGCCAGCTTTCCTCTCTATGAGCCGGCTAAAATGAAGACCCCTGTACAATATTCACAGC
AACAAAATTCTCCACAAAAACATAAGAACAAAGACCTGTATACTACTGGTAGAAGAGAAT
CTGTGAATCTGGGTAAAAGTGAAGGCTTCAAGGCTGGTGATAAAACTCTTACTCCCAGGA
AGCTTTCAACTAGAAATCGAACACCAGCTAAAGTTGAAGATGCAGCTGACTCTGCCACTA
AGCCAGAAAATCTCTCTTCCAAAACCAGAGGAAGTATTCCTACAGATGTGGAAGTTCTGC
CTACGGAAACTGAAATTCACAATGAGCCATTTTTAACTCTGTGGCTCACTCAAGTTGAGA
GGAAGATCCAAAAGGATTCCCTCAGCAAGCCTGAGAAATTGGGCACTACAGCTGGACAGA
TGTGCTCTGGGTTACCTGGTCTTAGTTCAGTTGATATCAACAACTTTGGTGATTCCATTA

gtaagtttatttaattgtaaatttatttttctaaaagatgaacaccttctatgtagctgt
gagaccttcattctttcagtagtgattagctttgtggaagagaatgtaagcacataaggc
acagggataagacagacacgcacgctgttttcgctaatagatgaatactgaaggcctagg
EXON 8  176 bp
caatcctttaggaactcttagtagcttagcttcaccaggattgcaagaatagaggcgtgc
tgtaggtactgtgtttcgatgacttttcacttggtttgtctttaatgctaacgtgaaata
aatcactagtcttggtatgttttttcattgctctttccacatttgtatccgttactttag
ATGAGAGTGAGGGAATACCTTTGAAAAGAAGGCGTGTGTCCTTTGGTGGGCACCTAAGAC
CTGAACTATTTGATGAAAACTTGCCTCCTAATACGCCTCTCAAAAGGGGAGAAGCCCCAA
CCAAAAGAAAGTCTCTGGTAATGCACACTCCACCTGTCCTGAAGAAAATCATCAAG
gtgagttgaacaagcagcatcccattcacgcccagtggctcacacaccgggtacctattc
ctttccaaatactgacacaagtagaattatgatgaagacctttatttatttattaaagaa
acaagtttttaaaaagacgaatgaaagctcattgatgtgggcaccagcaaaggagcccct
EXON 9  313 bp
cttttccttaaatgactgagacagtctcacctctaccatagtcttcaaagacagtggctt
aagcatttgatgcttcaagatttaaacagctgaaattcttaactgaataggtttttatca
gtcattccagagatgttagatccttgttaaggcttcttgtaaacaattttgtcttgtcag
GAACAGCCTCAACCATCAGGAAAACAAGAGTCAGGTTCAGAAATCCATGTGGAAGTGAAG
GCACAAAGCTTGGTTATAAGCCCTCCAGCTCCTAGTCCTAGGAAAACTCCAGTTGCCAGT
GATCAACGCCGTAGGTCCTGCAAAACAGCCCCTGCTTCCAGCAGCAAATCTCAGACAGAG
GTTCCTAAGAGAGGAGGGAGAAAGAGTGGCAACCTGCCTTCAAAGAGAGTGTCTATCAGC
CGAAGTCAACATGATATTTTACAGATGATATGTTCCAAAAGAAGAAGTGGTGCTTCGGAA
GCAAATCTGATTG
gttagtctgacattagaatacatatattaaggtgaattttttcatgaatgctaatttttg
aaaagtttcgtcttttccctttgacagttgcaaaatcatgggcagatgtagtaaaacttg
gtgcaaaacaaacacaaactaaagtcataaaacatggtcctcaaaggtcaatgaacaaaa
EXON 10  119 bp
caaagagagtgtctatcagccgaagtcaacatgatattttacagatgatatgttccaaaa
gaagaagtggtgcttcggaagcaaatctgattggttagtctgacattagaatacatatat
taaggtgaattttttcatgaatgctaatttttgaaaagtttcgtcttttccctttgacag
TTGCAAAATCATGGGCAGATGTAGTAAAACTTGGTGCAAAACAAACACAAACTAAAGTCA
TAAAACATGGTCCTCAAAGGTCAATGAACAAAAGGCAAAGAAGACCTGCTACTCCAAAG
gtaggggcctcactgaatggctgctttacacataccggtgtcatcgaagcttgcattcag
tgtggatttatgctttaatgtcctgtttacctccttcctgttttctacagaagcctgtgg
gcgaagttcacagtcaatttagtacaggccacgcaaactctccttgtaccataataatag
EXON 11  172 bp
aactaaagtcataaaacatggtcctcaaaggtcaatgaacaaaaggcaaagaagacctgc
tactccaaaggtaggggcctcactgaatggctgctttacacataccggtgtcatcgaagc
ttgcattcagtgtggatttatgctttaatgtcctgtttacctccttcctgttttctacag
AAGCCTGTGGGCGAAGTTCACAGTCAATTTAGTACAGGCCACGCAAACTCTCCTTGTACC
ATAATAATAGGGAAAGCTCATACTGAAAAAGTACATGTGCCTGCTCGACCCTACAGAGTG
CTCAACAACTTCATTTCCAACCAAAAAATGGACTTTAAGGAAGATCTTTCAG
gtaaaaacgtagtcttagatcttataaatcttttgactctactgttttttactgtgttaa
tgtttgttttgctaactttgtttatctgctgtgaaagagattataaaataaacgactcaa
tcacccttctggggtcttagtgttcagggaagataaagctgttttggcttgcaaagacaa
EXON 12  156 bp
tttttacaaaatgagtacattattaatggaatcactctttttatgaggcctatgtaccag
gatttcaagggaggaatctactgttatttcccaccatttgcacgttacatgtgagggctg
ggatggttgtctgcatgttagcaatatgtcaatcacttttcaaatattttcatttaacag
GAATAGCTGAAATGTTCAAGACCCCAGTGAAGGAGCAACCGCAGTTGACAAGCACATGTC
ACATCGCTATTTCAAATTCAGAGAATTTGCTTGGAAAACAGTTTCAAGGAACTGATTCAG
GAGAAGAACCTCTGCTCCCCACCTCAGAGAGTTTTG
gttggtttccttgtttcctaacactgtgatgttttgggataggaacatacagtattattt
ttttacaagcagtatgatattacttctctaaaacaaatgttcctggcacaaaataccatt
tccgtcttctctgttctaattgaaagggagatttcaatcagcagttgaactaacattggc
EXON 13  6845 bp
cattattcttaattgtgcatggctcttataagacagatttatagacacataagtagcctc
atgtcgttcagtgaatacgaagctaaatatttagttttttaccatattttatgaggctgt
aatactcgattgacatgagacactaatagaatgtttttattgtgtatgtttttatttcag
GAGGAAATGTGTTCTTCAGTGCACAGAATGCAGCAAAACAGCCATCTGATAAATGCTCTG
CAAGCCCTCCCTTAAGACGGCAGTGTATTAGAGAAAATGGAAACGTAGCAAAAACGCCCA
GGAACACCTACAAAATGACTTCTCTGGAGACAAAAACTTCAGATACTGAGACAGAGCCTT
CAAAAACAGTATCCACTGCAAACAGGTCAGGAAGGTCTACAGAGTTCAGGAATATACAGA
AGCTACCTGTGGAAAGTAAGAGTGAAGAAACAAATACAGAAATTGTTGAGTGCATCCTAA
AAAGAGGTCAGAAGGCAACACTACTACAACAAAGGAGAGAAGGAGAGATGAAGGAAATAG
AAAGACCTTTTGAGACATATAAGGAAAATATTGAATTAAAAGAAAACGATGAAAAGATGA
AAGCAATGAAGAGATCAAGAACTTGGGGGCAGAAATGTGCACCAATGTCTGACCTGACAG
ACCTCAAGAGCTTGCCTGATACAGAACTCATGAAAGACACGGCACGTGGCCAGAATCTCC
TCCAAACCCAAGATCATGCCAAGGCACCAAAGAGTGAGAAAGGCAAAATCACTAAAATGC
CCTGCCAGTCATTACAACCAGAACCAATAAACACCCCAACACACACAAAACAACAGTTGA
AGGCATCCCTGGGGAAAGTAGGTGTGAAAGAAGAGCTCCTAGCAGTCGGCAAGTTCACAC
GGACGTCAGGGGAGACCACGCACACGCACAGAGAGCCAGCAGGAGATGGCAAGAGCATCA
GAACGTTTAAGGAGTCTCCAAAGCAGATCCTGGACCCAGCAGCCCGTGTAACTGGAATGA
AGAAGTGGCCAAGAACGCCTAAGGAAGAGGCCCAGTCACTAGAAGACCTGGCTGGCTTCA
AAGAGCTCTTCCAGACACCAGGTCCCTCTGAGGAATCAATGACTGATGAGAAAACTACCA
AAATAGCCTGCAAATCTCCACCACCAGAATCAGTGGACACTCCAACAAGCACAAAGCAAT
GGCCTAAGAGAAGTCTCAGGAAAGCAGATGTAGAGGAAGAATTCTTAGCACTCAGGAAAC
TAACACCATCAGCAGGGAAAGCCATGCTTACGCCCAAACCAGCAGGAGGTGATGAGAAAG
ACATTAAAGCATTTATGGGAACTCCAGTGCAGAAACTGGACCTGGCAGGAACTTTACCTG
GCAGCAAAAGACAGCTACAGACTCCTAAGGAAAAGGCCCAGGCTCTAGAAGACCTGGCTG
GCTTTAAAGAGCTCTTCCAGACTCCTGGTCACACCGAGGAATTAGTGGCTGCTGGTAAAA
CCACTAAAATACCCTGCGACTCTCCACAGTCAGACCCAGTGGACACCCCAACAAGCACAA
AGCAACGACCCAAGAGAAGTATCAGGAAAGCAGATGTAGAGGGAGAACTCTTAGCGTGCA
GGAATCTAATGCCATCAGCAGGCAAAGCCATGCACACGCCTAAACCATCAGTAGGTGAAG
AGAAAGACATCATCATATTTGTGGGAACTCCAGTGCAGAAACTGGACCTGACAGAGAACT
TAACCGGCAGCAAGAGACGGCCACAAACTCCTAAGGAAGAGGCCCAGGCTCTGGAAGACC
TGACTGGCTTTAAAGAGCTCTTCCAGACCCCTGGTCATACTGAAGAAGCAGTGGCTGCTG
GCAAAACTACTAAAATGCCCTGCGAATCTTCTCCACCAGAATCAGCAGACACCCCAACAA
GCACAAGAAGGCAGCCCAAGACACCTTTGGAGAAAAGGGACGTACAGAAGGAGCTCTCAG
CCCTGAAGAAGCTCACACAGACATCAGGGGAAACCACACACACAGATAAAGTACCAGGAG
GTGAGGATAAAAGCATCAACGCGTTTAGGGAAACTGCAAAACAGAAACTGGACCCAGCAG
CAAGTGTAACTGGTAGCAAGAGGCACCCAAAAACTAAGGAAAAGGCCCAACCCCTAGAAG
ACCTGGCTGGCTTGAAAGAGCTCTTCCAGACACCAGTATGCACTGACAAGCCCACGACTC
ACGAGAAAACTACCAAAATAGCCTGCAGATCACAACCAGACCCAGTGGACACACCAACAA
GCTCCAAGCCACAGTCCAAGAGAAGTCTCAGGAAAGTGGACGTAGAAGAAGAATTCTTCG
CACTCAGGAAACGAACACCATCAGCAGGCAAAGCCATGCACACACCCAAACCAGCAGTAA
GTGGTGAGAAAAACATCTACGCATTTATGGGAACTCCAGTGCAGAAACTGGACCTGACAG
AGAACTTAACTGGCAGCAAGAGACGGCTACAAACTCCTAAGGAAAAGGCCCAGGCTCTAG
AAGACCTGGCTGGCTTTAAAGAGCTCTTCCAGACACGAGGTCACACTGAGGAATCAATGA
CTAACGATAAAACTGCCAAAGTAGCCTGCAAATCTTCACAACCAGACCCAGACAAAAACC
CAGCAAGCTCCAAGCGACGGCTCAAGACATCCCTGGGGAAAGTGGGCGTGAAAGAAGAGC
TCCTAGCAGTTGGCAAGCTCACACAGACATCAGGAGAGACTACACACACACACACAGAGC
CAACAGGAGATGGTAAGAGCATGAAAGCATTTATGGAGTCTCCAAAGCAGATCTTAGACT
CAGCAGCAAGTCTAACTGGCAGCAAGAGGCAGCTGAGAACTCCTAAGGGAAAGTCTGAAG
TCCCTGAAGACCTGGCCGGCTTCATCGAGCTCTTCCAGACACCAAGTCACACTAAGGAAT
CAATGACTAACGAAAAAACTACCAAAGTATCCTACAGAGCTTCACAGCCAGACCTAGTGG
ACACCCCAACAAGCTCCAAGCCACAGCCCAAGAGAAGTCTCAGGAAAGCAGACACTGAAG
AAGAATTTTTAGCATTTAGGAAACAAACGCCATCAGCAGGCAAAGCCATGCACACACCCA
AACCAGCAGTAGGTGAAGAGAAAGACATCAACACGTTTTTGGGAACTCCAGTGCAGAAAC
TGGACCAGCCAGGAAATTTACCTGGCAGCAATAGACGGCTACAAACTCGTAAGGAAAAGG
CCCAGGCTCTAGAAGAACTGACTGGCTTCAGAGAGCTTTTCCAGACACCATGCACTGATA
ACCCCACGACTGATGAGAAAACTACCAAAAAAATACTCTGCAAATCTCCGCAATCAGACC
CAGCGGACACCCCAACAAACACAAAGCAACGGCCCAAGAGAAGCCTCAAGAAAGCAGACG
TAGAGGAAGAATTTTTAGCATTCAGGAAACTAACACCATCAGCAGGCAAAGCCATGCACA
CGCCTAAAGCAGCAGTAGGTGAAGAGAAAGACATCAACACATTTGTGGGGACTCCAGTGG
AGAAACTGGACCTGCTAGGAAATTTACCTGGCAGCAAGAGACGGCCACAAACTCCTAAAG
AAAAGGCCAAGGCTCTAGAAGATCTGGCTGGCTTCAAAGAGCTCTTCCAGACACCAGGTC
ACACTGAGGAATCAATGACCGATGACAAAATCACAGAAGTATCCTGCAAATCTCCACAAC
CAGACCCAGTCAAAACCCCAACAAGCTCCAAGCAACGACTCAAGATATCCTTGGGGAAAG
TAGGTGTGAAAGAAGAGGTCCTACCAGTCGGCAAGCTCACACAGACGTCAGGGAAGACCA
CACAGACACACAGAGAGACAGCAGGAGATGGAAAGAGCATCAAAGCGTTTAAGGAATCTG
CAAAGCAGATGCTGGACCCAGCAAACTATGGAACTGGGATGGAGAGGTGGCCAAGAACAC
CTAAGGAAGAGGCCCAATCACTAGAAGACCTGGCCGGCTTCAAAGAGCTCTTCCAGACAC
CAGACCACACTGAGGAATCAACAACTGATGACAAAACTACCAAAATAGCCTGCAAATCTC
CACCACCAGAATCAATGGACACTCCAACAAGCACAAGGAGGCGGCCCAAAACACCTTTGG
GGAAAAGGGATATAGTGGAAGAGCTCTCAGCCCTGAAGCAGCTCACACAGACCACACACA
CAGACAAAGTACCAGGAGATGAGGATAAAGGCATCAACGTGTTCAGGGAAACTGCAAAAC
AGAAACTGGACCCAGCAGCAAGTGTAACTGGTAGCAAGAGGCAGCCAAGAACTCCTAAGG
GAAAAGCCCAACCCCTAGAAGACTTGGCTGGCTTGAAAGAGCTCTTCCAGACACCAATAT
GCACTGACAAGCCCACGACTCATGAGAAAACTACCAAAATAGCCTGCAGATCTCCACAAC
CAGACCCAGTGGGTACCCCAACAATCTTCAAGCCACAGTCCAAGAGAAGTCTCAGGAAAG
CAGACGTAGAGGAAGAATCCTTAGCACTCAGGAAACGAACACCATCAGTAGGGAAAGCTA
TGGACACACCCAAACCAGCAGGAGGTGATGAGAAAGACATGAAAGCATTTATGGGAACTC
CAGTGCAGAAATTGGACCTGCCAGGAAATTTACCTGGCAGCAAAAGATGGCCACAAACTC
CTAAGGAAAAGGCCCAGGCTCTAGAAGACCTGGCTGGCTTCAAAGAGCTCTTCCAGACAC
CAGGCACTGACAAGCCCACGACTGATGAGAAAACTACCAAAATAGCCTGCAAATCTCCAC
AACCAGACCCAGTGGACACCCCAGCAAGCACAAAGCAACGGCCCAAGAGAAACCTCAGGA
AAGCAGACGTAGAGGAAGAATTTTTAGCACTCAGGAAACGAACACCATCAGCAGGCAAAG
CCATGGACACACCAAAACCAGCAGTAAGTGATGAGAAAAATATCAACACATTTGTGGAAA
CTCCAGTGCAGAAACTGGACCTGCTAGGAAATTTACCTGGCAGCAAGAGACAGCCACAGA
CTCCTAAGGAAAAGGCTGAGGCTCTAGAGGACCTGGTTGGCTTCAAAGAACTCTTCCAGA
CACCAGGTCACACTGAGGAATCAATGACTGATGACAAAATCACAGAAGTATCCTGTAAAT
CTCCACAGCCAGAGTCATTCAAAACCTCAAGAAGCTCCAAGCAAAGGCTCAAGATACCCC
TGGTGAAAGTGGACATGAAAGAAGAGCCCCTAGCAGTCAGCAAGCTCACACGGACATCAG
GGGAGACTACGCAAACACACACAGAGCCAACAGGAGATAGTAAGAGCATCAAAGCGTTTA
AGGAGTCTCCAAAGCAGATCCTGGACCCAGCAGCAAGTGTAACTGGTAGCAGGAGGCAGC
TGAGAACTCGTAAGGAAAAGGCCCGTGCTCTAGAAGACCTGGTTGACTTCAAAGAGCTCT
TCTCAGCACCAGGTCACACTGAAGAGTCAATGACTATTGACAAAAACACAAAAATTCCCT
GCAAATCTCCCCCACCAGAACTAACAGACACTGCCACGAGCACAAAGAGATGCCCCAAGA
CACGTCCCAGGAAAGAAGTAAAAGAGGAGCTCTCAGCAGTTGAGAGGCTCACGCAAACAT
CAGGGCAAAGCACACACACACACAAAGAACCAGCAAGCGGTGATGAGGGCATCAAAGTAT
TGAAGCAACGTGCAAAGAAGAAACCAAACCCAGTAGAAGAGGAACCCAGCAGGAGAAGGC
CAAGAGCACCTAAGGAAAAGGCCCAACCCCTGGAAGACCTGGCCGGCTTCACAGAGCTCT
CTGAAACATCAGGTCACACTCAGGAATCACTGACTGCTGGCAAAGCCACTAAAATACCCT
GCGAATCTCCCCCACTAGAAGTGGTAGACACCACAGCAAGCACAAAGAGGCATCTCAGGA
CACGTGTGCAGAAGGTACAAGTAAAAGAAGAGCCTTCAGCAGTCAAGTTCACACAAACAT
CAGGGGAAACCACGGATGCAGACAAAGAACCAGCAGGTGAAGATAAAGGCATCAAAGCAT
TGAAGGAATCTGCAAAACAGACACCGGCTCCAGCAGCAAGTGTAACTGGCAGCAGGAGAC
GGCCAAGAGCACCCAGGGAAAGTGCCCAAGCCATAGAAGACCTAGCTGGCTTCAAAGACC
CAGCAGCAGGTCACACTGAAGAATCAATGACTGATGACAAAACCACTAAAATACCCTGCA
AATCATCACCAGAACTAGAAGACACCGCAACAAGCTCAAAGAGACGGCCCAGGACACGTG
CCCAGAAAGTAGAAGTGAAGGAGGAGCTGTTAGCAGTTGGCAAGCTCACACAAACCTCAG
GGGAGACCACGCACACCGACAAAGAGCCGGTAGGTGAGGGCAAAGGCACGAAAGCATTTA
AGCAACCTGCAAAGCGGAAGCTGGACGCAGAAGATGTAATTGGCAGCAGGAGACAGCCAA
GAGCACCTAAGGAAAAGGCCCAACCCCTGGAAGATCTGGCCAGCTTCCAAGAGCTCTCTC
AAACACCAGGCCACACTGAGGAACTGGCAAATGGTGCTGCTGATAGCTTTACAAGCGCTC
CAAAGCAAACACCTGACAGTGGAAAACCTCTAAAAATATCCAGAAGAGTTCTTCGGGCCC
CTAAAGTAGAACCCGTGGGAGACGTGGTAAGCACCAGAGACCCTGTAAAATCACAAAGCA
AAAGCAACACTTCCCTGCCCCCACTGCCCTTCAAGAGGGGAGGTGGCAAAGATGGAAGCG
TCACGGGAACCAAGAGGCTGCGCTGCATGCCAGCACCAGAGGAAATTGTGGAGGAGCTGC
CAGCCAGCAAGAAGCAGAGGGTTGCTCCCAGGGCAAGAGGCAAATCATCCGAACCCGTGG
TCATCATGAAGAGAAGTTTGAGGACTTCTGCAAAAAGAATTGAACCTGCGGAAGAGCTGA
ACAGCAACGACATGAAAACCAACAAAGAGGAACACAAATTACAAGACTCGGTCCCTGAAA
ATAAG
gtgagaggaagtattacagcatcactcaatatcgtcttggatagttgtgaatttctgtgt
tatactttgcatgtaacctgacgttataagtggttatcctttccccagagggtttccttt
aacactgaataactgcaggccatggtaaagaatcttcttgggacctatagagggaataga
EXON 14  444 bp
agcaaagtaccaaggcattaccttgactatcctagatgacaagtctcttagacaattcat
cagtgtgtgattttcaaatgatttctccttttaggttactgttgattgtgctccctgttg
aattttgaagtttgttttactaattattggaattttgtggatgtcttctcatttctttag
GGAATATCCCTGCGCTCCAGACGCCAAAATAAGACTGAGGCAGAACAGCAAATAACTGAG
GTCTTTGTATTAGCAGAAAGAATAGAAATAAACAGAAATGAAAAGAAGCCCATGAAGACC
TCCCCAGAGATGGACATTCAGAATCCAGATGATGGAGCCCGGAAACCCATACCTAGAGAC
AAAGTCACTGAGAACAAAAGGTGCTTGAGGTCTGCTAGACAGAATGAGAGCTCCCAGCCT
AAGGTGGCAGAGGAGAGCGGAGGGCAGAAGAGTGCGAAGGTTCTCATGCAGAATCAGAAA
GGGAAAGGAGAAGCAGGAAATTCAGACTCCATGTGCCTGAGATCAAGAAAGACAAAAAGC
CAGCCTGCAGCAAGCACTTTGGAGAGCAAATCTGTGCAGAGAGTAACGCGGAGTGTCAAG
AGGTGTGCAGAAAATCCAAAGAAG
gtaagccatttactgtttccctgttttaaaagacacagaatgttttgatgtattttttgc
ccaaggttgcaaaggcaaacaaaaagcattatcttcaacagcactctgccagctcccagt
tacattaatggaaggagcattatgctaagacataaatttggtcattttagttatattttg
EXON 15  2593 bp
tcaagaaaaacaatgttaatggaatatattttaaaacttatttccaacctcaaaattaat
tttctgcaactaaggacctgcataatacctagtaagcctttggggttttgcagaggaggt
cgattctaaaaatgggtgtttaaattacttaagagttctattttttttcttcccacacag
GCTGAGGACAATGTGTGTGTCAAGAAAATAAGAACCAGAAGTCATAGGGACAGTGAAGAT
ATTTGACAGAAAAATCGAACTGGGAAAAATATAATAAAGTTAGTTTTGTGATAAGTTCTA
GTGCAGTTTTTGTCATAAATTACAAGTGAATTCTGTAAGTAAGGCTGTCAGTCTGCTTAA
GGGAAGAAAACTTTGGATTTGCTGGGTCTGAATCGGCTTCATAAACTCCACTGGGAGCAC
TGCTGGGCTCCTGGACTGAGAATAGTTGAACACCGGGGGCTTTGTGAAGGAGTCTGGGCC
AAGGTTTGCCCTCAGCTTTGCAGAATGAAGCCTTGAGGTCTGTCACCACCCACAGCCACC
CTACAGCAGCCTTAACTGTGACACTTGCCACACTGTGTCGTCGTTTGTTTGCCTATGTCC
TCCAGGGCACGGTGGCAGGAACAACTATCCTCGTCTGTCCCAACACTGAGCAGGCACTCG
GTAAACACGAATGAATGGATGAGCGCACGGATGAATGGAGCTTACAAGATCTGTCTTTCC
AATGGCCGGGGGCATTTGGTCCCCAAATTAAGGCTATTGGACATCTGCACAGGACAGTCC
TATTTTTGATGTCCTTTCCTTTCTGAAAATAAAGTTTTGTGCTTTGGAGAATGACTCGTG
AGCACATCTTTAGGGACCAAGAGTGACTTTCTGTAAGGAGTGACTCGTGGCTTGCCTTGG
TCTCTTGGGAATACTTTTCTAACTAGGGTTGCTCTCACCTGAGACATTCTCCACCCGCGG
AATCTCAGGGTCCCAGGCTGTGGGCCATCACGACCTCAAACTGGCTCCTAATCTCCAGCT
TTCCTGTCATTGAAAGCTTCGGAAGTTTACTGGCTCTGCTCCCGCCTGTTTTCTTTCTGA
CTCTATCTGGCAGCCCGATGCCACCCAGTACAGGAAGTGACACCAGTACTCTGTAAAGCA
TCATCATCCTTGGAGAGACTGAGCACTCAGCACCTTCAGCCACGATTTCAGGATCGCTTC
CTTGTGAGCCGCTGCCTCCGAAATCTCCTTTGAAGCCCAGACATCTTTCTCCAGCTTCAG
ACTTGTAGATATAACTCGTTCATCTTCATTTACTTTCCACTTTGCCCCCTGTCCTCTCTG
TGTTCCCCAAATCAGAGAATAGCCCGCCATCCCCCAGGTCACCTGTCTGGATTCCTCCCC
ATTCACCCACCTTGCCAGGTGCAGGTGAGGATGGTGCACCAGACAGGGTAGCTGTCCCCC
AAAATGTGCCCTGTGCGGGCAGTGCCCTGTCTCCACGTTTGTTTCCCCAGTGTCTGGCGG
GGAGCCAGGTGACATCATAAATACTTGCTGAATGAATGCAGAAATCAGCGGTACTGACTT
GTACTATATTGGCTGCCATGATAGGGTTCTCACAGCGTCATCCATGATCGTAAGGGAGAA
TGACATTCTGCTTGAGGGAGGGAATAGAAAGGGGCAGGGAGGGGACATCTGAGGGCTTCA
CAGGGCTGCAAAGGGTACAGGGATTGCACCAGGGCAGAACAGGGGAGGGTGTTCAAGGAA
GAGTGGCTCTTAGCAGAGGCACTTTGGAAGGTGTGAGGCATAAATGCTTCCTTCTACGTA
GGCCAACCTCAAAACTTTCAGTAGGAATGTTGCTATGATCAAGTTGTTCTAACACTTTAG
ACTTAGTAGTAATTATGAACCTCACATAGAAAAATTTCATCCAGCCATATGCCTGTGGAG
TGGAATATTCTGTTTAGTAGAAAAATCCTTTAGAGTTCAGCTCTAACCAGAAATCTTGCT
GAAGTATGTCAGCACCTTTTCTCACCCTGGTAAGTACAGTATTTCAAGAGCACGCTAAGG
GTGGTTTTCATTTTACAGGGCTGTTGATGATGGGTTAAAAATGTTCATTTAAGGGCTACC
CCCGTGTTTAATAGATGAACACCACTTCTACACAACCCTCCTTGGTACTGGGGGAGGGAG
AGATCTGACAAATACTGCCCATTCCCCTAGGCTGACTGGATTTGAGAACAAATACCCACC
CATTTCCACCATGGTATGGTAACTTCTCTGAGCTTCAGTTTCCAAGTGAATTTCCATGTA
ATAGGACATTCCCATTAAATACAAGCTGTTTTTACTTTTTCGCCTCCCAGGGCCTGTGGG
ATCTGGTCCCCCAGCCTCTCTTGGGCTTTCTTACACTAACTCTGTACCTACCATCTCCTG
CCTCCCTTAGGCAGGCACCTCCAACCACCACACACTCCCTGCTGTTTTCCCTGCCTGGAA
CTTTCCCTCCTGCCCCACCAAGATCATTTCATCCAGTCCTGAGCTCAGCTTAAGGGAGGC
TTCTTGCCTGTGGGTTCCCTCACCCCCATGCCTGTCCTCCAGGCTGGGGCAGGTTCTTAG
TTTGCCTGGAATTGTTCTGTACCTCTTTGTAGCACGTAGTGTTGTGGAAACTAAGCCACT
AATTGAGTTTCTGGCTCCCCTCCTGGGGTTGTAAGTTTTGTTCATTCATGAGGGCCGACT
GCATTTCCTGGTTACTCTATCCCAGTGACCAGCCACAGGAGATGTCCAATAAAGTATGTG
ATGAAATGGTCTT
aaaacccatggtatttttattatagggagagtggggaaagaaactaagtgtgggtggggc
agacaggccagtgtaagagagactggttcattacgttccattttcatttctacaaggact
tggctggatggtcattttctctcttggccaataagtcatcgcagctgcttttagtcctgc