Gene FZD8 Variant 1
DNA : 3.18 KbNT_008705
mRNA : 3186 bp NM_031866
CDS : 2085 bp NP_114072
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  3186 bp
gccgcgccgctgcggacgcgcccctagaaggggttagattatcggcagacccccctcccg
ggcgaagcataagggagaccccagatcacccgctgtacccgtctgcggctctctcgtggg
ccccccccccggcacccctctgcgcgccgcctggagggcgagggcaccgggccgaggcgc
ACAGCATGGAGTGGGGTTACCTGTTGGAAGTGACCTCGCTGCTGGCCGCCTTGGCGCTGC
TGCAGCGCTCTAGCGGCGCTGCGGCCGCCTCGGCCAAGGAGCTGGCATGCCAAGAGATCA
CCGTGCCGCTGTGTAAGGGCATCGGCTACAACTACACCTACATGCCCAATCAGTTCAACC
ACGACACGCAAGACGAGGCGGGCCTGGAGGTGCACCAGTTCTGGCCGCTGGTGGAGATCC
AGTGCTCGCCCGATCTCAAGTTCTTCCTGTGCAGCATGTACACGCCCATCTGCCTAGAGG
ACTACAAGAAGCCGCTGCCGCCCTGCCGCTCGGTGTGCGAGCGCGCCAAGGCCGGCTGCG
CGCCGCTCATGCGCCAGTACGGCTTCGCCTGGCCCGACCGCATGCGCTGCGACCGGCTGC
CCGAGCAAGGCAACCCTGACACGCTGTGCATGGACTACAACCGCACCGACCTAACCACCG
CCGCGCCCAGCCCGCCGCGCCGCCTGCCGCCGCCGCCGCCCGGCGAGCAGCCGCCTTCGG
GCAGCGGCCACGGCCGCCCGCCGGGGGCCAGGCCCCCGCACCGCGGCGGCGGCAGGGGCG
GTGGCGGCGGGGACGCGGCGGCGCCCCCAGCTCGCGGCGGCGGCGGTGGCGGGAAGGCGC
GGCCCCCTGGCGGCGGCGCGGCTCCCTGCGAGCCCGGGTGCCAGTGCCGCGCGCCTATGG
TGAGCGTGTCCAGCGAGCGCCACCCGCTCTACAACCGCGTCAAGACAGGCCAGATCGCTA
ACTGCGCGCTGCCCTGCCACAACCCCTTTTTCAGCCAGGACGAGCGCGCCTTCACCGTCT
TCTGGATCGGCCTGTGGTCGGTGCTCTGCTTCGTGTCCACCTTCGCCACCGTCTCCACCT
TCCTTATCGACATGGAGCGCTTCAAGTACCCGGAGCGGCCCATTATCTTCCTCTCGGCCT
GCTACCTCTTCGTGTCGGTGGGCTACCTAGTGCGCCTGGTGGCGGGCCACGAGAAGGTGG
CGTGCAGCGGTGGCGCGCCGGGCGCGGGGGGCGCTGGGGGCGCGGGCGGCGCGGCGGCGG
GCGCGGGCGCGGCGGGCGCGGGCGCGGGCGGCCCGGGCGGGCGCGGCGAGTACGAGGAGC
TGGGCGCGGTGGAGCAGCACGTGCGCTACGAGACCACCGGCCCCGCGCTGTGCACCGTGG
TCTTCTTGCTGGTCTACTTCTTCGGCATGGCCAGCTCCATCTGGTGGGTGATCTTGTCGC
TCACATGGTTCCTGGCGGCCGGTATGAAGTGGGGCAACGAAGCCATCGCCGGCTACTCGC
AGTACTTCCACCTGGCCGCGTGGCTTGTGCCCAGCGTCAAGTCCATCGCGGTGCTGGCGC
TCAGCTCGGTGGACGGCGACCCGGTGGCGGGCATCTGCTACGTGGGCAACCAGAGCCTGG
ACAACCTGCGCGGCTTCGTGCTGGCGCCGCTGGTCATCTACCTCTTCATCGGCACCATGT
TCCTGCTGGCCGGCTTCGTGTCCCTCTTCCGCATCCGCTCGGTCATCAAGCAACAGGACG
GCCCCACCAAGACGCACAAGCTGGAGAAGCTGATGATCCGCCTGGGCCTGTTCACCGTGC
TCTACACCGTGCCCGCCGCGGTGGTGGTCGCCTGCCTCTTCTACGAGCAGCACAACCGCC
CGCGCTGGGAGGCCACGCACAACTGCCCGTGCCTGCGGGACCTGCAGCCCGACCAGGCAC
GCAGGCCCGACTACGCCGTCTTCATGCTCAAGTACTTCATGTGCCTAGTGGTGGGCATCA
CCTCGGGCGTGTGGGTCTGGTCCGGCAAGACGCTGGAGTCCTGGCGCTCCCTGTGCACCC
GCTGCTGCTGGGCCAGCAAGGGCGCCGCGGTGGGCGGGGGCGCGGGCGCCACGGCCGCGG
GGGGTGGCGGCGGGCCGGGGGGCGGCGGCGGCGGGGGACCCGGCGGCGGCGGGGGGCCGG
GCGGCGGCGGGGGCTCCCTCTACAGCGACGTCAGCACTGGCCTGACGTGGCGGTCGGGCA
CGGCGAGCTCCGTGTCTTATCCAAAGCAGATGCCATTGTCCCAGGTCTGAGCGGAGGGGA
GGGGGCGCCCAGGAGGGGTGGGGAGGGGGGCGAGGAGAGCCAAGTGCAGCGAAGGGACAC
TTGATGGGCTGAGGTTCCCACCCCTTCACAGTGTTGATTGCTATTAGCATGATAATGAAC
TCTTAATGGTATCCATTAGCTGGGACTTAAATGACTCACTTAGAACAAAGTACCTGGCAT
TGAAGCCTCCCAGACCCAGCCCCTTTTCCTCCATTGATGTGCGGGGAGCTCCTCCCGCCA
CGCGTTAATTTCTGTTGGCTGAGGAGGGTGGACTCTGCGGCGTTTCCAGAACCCGAGATT
TGGAGCCCTCCCTGGCTGCACTTGGCTGGGTTTGCAGTCAGATACACAGATTTCACCTGG
GAGAACCTCTTTTTCTCCCTCGACTCTTCCTACGTAAACTCCCACCCCTGACTTACCCTG
GAGGAGGGGTGACCGCCACCTGATGGGATTGCACGGTTTGGGTATTCTTAATGACCAGGC
AAATGCCTTAAGTAAACAAACAAGAAATGTCTTAATTATACACCCCACGTAAATACGGGT
TTCTTACATTAGAGGATGTATTTATATAATTATTTGTTAAATTGTAAAAAAAAAAGTGTA
AAATATGTATATATCCAAAGATATAGTGTGTACATTTTTTTGTAAAAAGTTTAGAGGCTT
ACCCCTGTAAGAACAGATATAAGTATTCTATTTTGTCAATAAAATGACTTTTGATAAATG
ATTTAACCATTGCCCTCTCCCCCGCCTCTTCTGAGCTGTCACCTTTAAAGTGCTTGCTAA
GGACGCATGGGGAAAATGGACATTTTCTGGCTTGTCATTCTGTACACTGACCTTAGGCAT
GGAGAAAATTACTTGTTAAACTCTAGTTCTTAAGTTGTTAGCCAAGTAAATATCATTGTT
GAACTGAAATCAAAATTGAGTTTTTGCACCTTCCCCAAAGACGGTGTTTTTCATGGGAGC
TCTTTTCTGATCCATGGATAACAACTCTCACTTTAGTGGATGTAAATGGAACTTCTGCAA
GGCAGTAATTCCCCTTAGGCCTTGTTATTTATCCTGCATGGTATCACTAAAGGTTTCAAA
ACCCTG
cattcatttctggagtccgtgattttgaaagcacctggtgttccagggagggaacgcatt
gctgaggtgtagaggttaatgttttaaaccatagctcaccctttacagtagaagtcactt
gacaatctggtaggggagcaggcgctcttcaatggattaaactaacgggttaacatctta