Gene FXYD4 Variant 1
DNA : 4.69 KbNT_033985
mRNA : 772 bp NM_173160
CDS : 270 bp NP_775183
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  56 bp
aaaaaaaaaaaaaaaaaaaaaaaaaaagaagccaaaagagggtcttcggcccagcccgcc
cctccccaacagccctgggtgtggcagggagcctgaccagttccctccagcctgcgtcat
ggagccctgggcgtggctgcagggtttaaagagccgacccacgtgcccagcagcctcctc
AGATCCGTTCTCTGCGCTGCCAGCTCAGGTGAGCCCTCGCCAAGGTGACCTCGCAG
gtgagcaggcgtccactttggggctgctgggtgaagggggtgggtgcccaagaattctga
gtaatgaggagcctgttgaggggtctgaggacagatatggctgcagcagccgcttgaagg
cctcctgctttgcacccactatcatatggatggtgggttgggggttggaggaaacagaag
EXON 2  46 bp
agtgctgggattataggtgtgagccactgcgcccggcctatggatgtatttattgtaaca
ggtttttagtgcttactgtgtgctaggcatagttcttaggcttgacaaatagtagttcac
gtaattccatcgctataaccttatgaggttgctactattctgatgatcctccttttacag
GACACTGGTGAAGGAGCAGTGAGGAACCTGCAGAGTCACACAGTTG
gtaagttgctaagaagggacccagcccagacagctggccctggatctgtgatctcatcag
gaggccagagctgggtacagcagatgatgacaatggcttcagtattgaaaacttgaccac
actaggctaacaatatgcagagggctgggagggggcctgcgctcaaagactcagcctccc
EXON 3  269 bp
aagctccatttttttttttcttctctgaaatagagacaataatagtatcttcctcatggg
gaggagtagggggtgggtttgtcgcatggattttaacaacgccttctacagcacttactc
tgtgcaggcacagttttgagctcttagcttgtgcttactcaatccacacaactcccccag
GCCACCACCATCTCTAGATGGGAAGACAGAAAGTAGTTACTTTCCCAAGATCTCCCCACA
AGCAAGTGTATCCTTGGGGTTTGTACACCTACTTTCACCATGGGGCTCTGCCTGCCCCCG
CCCCTGCCTCCTCTCGCTGACCAATTGAGCTGTGAGCCTGGAGCAGATCCGTGGGCTGCA
GACCCCCGCCCCAGTGCCTCTCCCCCTGCAGCCCTGCCCCTCGAACTGTGACATGGAGAG
AGTGACCCTGGCCCTTCTCCTACTGGCAG
gtgagtcctcccagtctcctgggaccctcttgcattcaccccacccacaaaggcagcaaa
agccagacaacatctcctttgggagtctggtgttcaatcagcatgctttatttaaactgc
caatttagagagaaacatgaaggaaatgacagtacaggtaggatgagaatattgcaaaaa
EXON 4  33 bp
ggacagcagggcttgggcggggccacaccctgaggctgtgtggggctggggagggcgtga
ggaagggaactggtggctccagggtcaccccacaacctccgggctggggtcctgctgtct
ggcttacttggacaccagtgtcatgaattcccacacattttctctgctcctcccacacag
GCCTGACTGCCTTGGAAGCCAATGACCCATTTG
gtgagtgaggcccccaaacagcctgcccactctgcccacatctcccctctgacacccaca
tcctgtctcctggttctggttctgaagtctttttgccccactttttctagccaataaaga
cgatcccttctactatggtaagagctgatattcccacccccaccctacccttgcctatcc
EXON 5  27 bp
tgaattcccacacattttctctgctcctcccacacaggcctgactgccttggaagccaat
gacccatttggtgagtgaggcccccaaacagcctgcccactctgcccacatctcccctct
gacacccacatcctgtctcctggttctggttctgaagtctttttgccccactttttctag
CCAATAAAGACGATCCCTTCTACTATG
gtaagagctgatattcccacccccaccctacccttgcctatcctggacctctttgctaga
caagttggtgaggggtagtgtggacctagtgtagacaaagtgggatgggggattaaacct
ggtctctgtgagagcgtcgctccaacaaggggagggtggccacaggatgcttaggaaccc
EXON 6  75 bp
acccagcctcactttttttcttcttagtgtttccccacgagacgcagaatgatgcctctg
ttgctggcttgtctttatgtatatggcagcggctggcacaagcaggggctcaggagtgtc
ttttgaatgaatgactgaggccccaggctggtgcaagctcactctctgtacccaccccag
ACTGGAAAAACCTGCAGCTGAGCGGACTGATCTGCGGAGGGCTCCTGGCCATTGCTGGGA
TCGCGGCAGTTCTGA
gtgagtggcaggacaggtggggctggaggacagggtggggctggcggacagggtggggca
gaaagagagagtgctctcattccagcactgaccctggcgctgacccctctctctctccca
ggtggcaaatgcaaatgcaagagcagccagaagcagcacaggtgagcctgaccctatggt
EXON 7  40 bp
gctgagcggactgatctgcggagggctcctggccattgctgggatcgcggcagttctgag
tgagtggcaggacaggtggggctggaggacagggtggggctggcggacagggtggggcag
aaagagagagtgctctcattccagcactgaccctggcgctgacccctctctctctcccag
GTGGCAAATGCAAATGCAAGAGCAGCCAGAAGCAGCACAG
gtgagcctgaccctatggtgccctcctccttcggggcagaactacggggggacagtcctg
acctggagagtggacagcatcctggccactcgctgggcttgcagctggctttgttattca
gatagtcaaccctgaagggccccagtcaggaaagctctgacctcggtattgtgggaagtg
EXON 8  38 bp
tcagatagtcaaccctgaagggccccagtcaggaaagctctgacctcggtattgtgggaa
gtgaccatggaaggagagcaaggacttgcactcctggggccgggcagcaagagtctggga
tataggggagaaggtcctccaggctaacctgatactactctgatgtggtcctttctctag
TCCTGTACCTGAGAAGGCCATCCCACTCATCACTCCAG
gtgagacgggcttctgtgggctgagggggtgtctgtgtaaggactgtgtctgatggcctg
cccgccactctccgcaggctctgccactacttgctgagcacaggactggcctccagggat
ggcctgaagcctaacactggcccccagcacctcctcccctgggaggccttatcctcaagg
EXON 9  188 bp
tgggatataggggagaaggtcctccaggctaacctgatactactctgatgtggtcctttc
tctagtcctgtacctgagaaggccatcccactcatcactccaggtgagacgggcttctgt
gggctgagggggtgtctgtgtaaggactgtgtctgatggcctgcccgccactctccgcag
GCTCTGCCACTACTTGCTGAGCACAGGACTGGCCTCCAGGGATGGCCTGAAGCCTAACAC
TGGCCCCCAGCACCTCCTCCCCTGGGAGGCCTTATCCTCAAGGAAGGACTTCTCTCCAAG
GGCAGGCTGTTAGGCCCCTTTCTGATCAGGAGGCTTCTTTATGAATTAAACTCGCCCCAC
CACCCCCT
cctcggtagtcttgtgatccatcgtctttgggtctgggggtgggtaatcccttggattgc
tgactttccctggatgcccactcccagcaagcttcccagtccctgagtccctgccgccca
actgtctcctatggctcccactccagcaagccccacagagagacccatgcactgtgagat