Gene EGR2 Variant 1
DNA : 4.37 KbNT_008583
mRNA : 2979 bp NM_000399
CDS : 1431 bp NP_000390
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  507 bp
cgcctgcgagctggaagtcgcgagcccggcggagtccgcgcggccgagcccgtgtatgca
aatcagccatgtgacggcaaaagccgcctggcccagccctgttcctcagtccatatatgg
gcagcgacgtcacgggtattgaagacctgcccataaatacttagagcaacactttccgtc
TAACTGAGCGAGGAGCAATTGATTAATAGCTCGGCGAGGGGACTCACTGACTGTTATAAT
AACACTACACCAGCAACTCCTGGCTTCCCAGCAGCCGGAACACAGACAGGAGAGAGTCAG
TGGCAAATAGACATTTTTCTTATTTCTTAAAAAACAGCAACTTGTTTGCTACTTTTATTT
CTGTTGATTTTTTTTTCTTGGTGTGTGTGGTGGTTGTTTTTAAGTGTGGAGGGCAAAAGG
AGATACCATCCCAGGCTCAGTCCAACCCCTCTCCAAAACGGCTTTTCTGACACTCCAGGT
AGCGAGGGAGTTGGGTCTCCAGGTTGTGCGAGGAGCAAATGATGACCGCCAAGGCCGTAG
ACAAAATCCCAGTAACTCTCAGTGGTTTTGTGCACCAGCTGTCTGACAACATCTACCCGG
TGGAGGACCTCGCCGCCACGTCGGTGACCATCTTTCCCAATGCCGAACTGGGAGGCCCCT
TTGACCAGATGAACGGAGTGGCCGGAG
gtaagccgcgtgtcttcgcaggcccggacctgcgcggcccggaggtggtggatggggtgc
agtgggtgtgcgggaatcgcaggagaggattggggctccaggtggacggtgctgactgca
ctggctttgaagactggaagtgggtgcaggaggaacctgcgacagctgagaccagggcgc
EXON 2  2472 bp
gttgggctggcctcttcttacagtctgtgggcctcaatttccccaccttttggactttgc
cacagctctacagtgctgagactctcggccttggaaatggacctatgtgagcgggggtga
gaagggagtcctggctgtattttcattgttccacctccattctgcctttcccctccccag
ATGGCATGATCAACATTGACATGACTGGAGAGAAGAGGTCGTTGGATCTCCCATATCCCA
GCAGCTTTGCTCCCGTCTCTGCACCTAGAAACCAGACCTTCACTTACATGGGCAAGTTCT
CCATTGACCCTCAGTACCCTGGTGCCAGCTGCTACCCAGAAGGCATAATCAATATTGTGA
GTGCAGGCATCTTGCAAGGGGTCACTTCCCCAGCTTCAACCACAGCCTCATCCAGCGTCA
CCTCTGCCTCCCCCAACCCACTGGCCACAGGACCCCTGGGTGTGTGCACCATGTCCCAGA
CCCAGCCTGACCTGGACCACCTGTACTCTCCGCCACCGCCTCCTCCTCCTTATTCTGGCT
GTGCAGGAGACCTCTACCAGGACCCTTCTGCGTTCCTGTCAGCAGCCACCACCTCCACCT
CTTCCTCTCTGGCCTACCCACCACCTCCTTCCTATCCGTCCCCCAAGCCAGCCACGGACC
CAGGTCTCTTCCCAATGATCCCAGACTATCCTGGATTCTTTCCATCTCAGTGCCAGAGAG
ACCTACATGGTACAGCTGGCCCAGACCGTAAGCCCTTTCCCTGCCCACTGGACACCCTGC
GGGTGCCCCCTCCACTCACTCCACTCTCTACAATCCGTAACTTTACCCTGGGGGGCCCCA
GTGCTGGGGTGACCGGACCAGGGGCCAGTGGAGGCAGCGAGGGACCCCGGCTGCCTGGTA
GCAGCTCAGCAGCAGCAGCAGCCGCCGCCGCCGCCGCCTATAACCCACACCACCTGCCAC
TGCGGCCCATTCTGAGGCCTCGCAAGTACCCCAACAGACCCAGCAAGACGCCGGTGCACG
AGAGGCCCTACCCGTGCCCAGCAGAAGGCTGCGACCGGCGGTTCTCCCGCTCTGACGAGC
TGACACGGCACATCCGAATCCACACTGGGCATAAGCCCTTCCAGTGTCGGATCTGCATGC
GCAACTTCAGCCGCAGTGACCACCTCACCACCCATATCCGCACCCACACCGGTGAGAAGC
CCTTCGCCTGTGACTACTGTGGCCGAAAGTTTGCCCGGAGTGATGAGAGGAAGCGCCACA
CCAAGATCCACCTGAGACAGAAAGAGCGGAAAAGCAGTGCCCCCTCTGCATCGGTGCCAG
CCCCCTCTACAGCCTCCTGCTCTGGGGGCGTGCAGCCTGGGGGTACCCTGTGCAGCAGTA
ACAGCAGCAGTCTTGGCGGAGGGCCGCTCGCCCCTTGCTCCTCTCGGACCCGGACACCTT
GAGATGAGACTCAGGCTGATACACCAGCTCCCAAAGGTCCCGGAGGCCCTTTGTCCACTG
GAGCTGCACAACAAACACTACCACCCTTTCCTGTCCCTCTCTCCCTTTGTTGGGCAAAGG
GCTTTGGTGGAGCTAGCACTGCCCCCTTTCCACCTAGAAGCAGGTTCTTCCTAAAACTTA
GCCCATTCTAGTCTCTCTTAGGTGAGTTGACTATCAACCCAAGGCAAAGGGGAGGCTCAG
AAGGAGGTGGTGTGGGGACCCCTGGCCAAGAGGGCTGAGGTCTGACCCTGCTTTAAAGGG
TTGTTTGACTAGGTTTTGCTACCCCACTTCCCCTTATTTTGACCCATCACAGGTTTTTGA
CCCTGGATGTCAGAGTTGATCTAAGACGTTTTCTACAATAGGTTGGGAGATGCTGATCCC
TTCAAGTGGGGACAGCAAAAAGACAAGCAAAACTGATGTGCACTTTATGGCTTGGGACTG
ATTTGGGGGACATTGTACAGTGAGTGAAGTATAGCCTTTATGCCACACTCTGTGGCCCTA
AAATGGTGAATCAGAGCATATCTAGTTGTCTCAACCCTTGAAGCAATATGTATTATAAAC
TCAGAGAACAGAAGTGCAATGTGATGGGAGGAACATAGCAATATCTGCTCCTTTTCGAGT
TGTTTGAGAAATGTAGGCTATTTTTTCAGTGTATATCCACTCAGATTTTGTGTATTTTTG
ATGTACACTGTTCTCTAAATTCTGAATCTTTGGGAAAAAATGTAAAGCATTTATGATCTC
AGAGGTTAACTTATTTAAGGGGGATGTACATATATTCTCTGAAACTAGGATGCATGCAAT
TGTGTTGGAAGTGTCCTTGGTGCCTTGTGTGATGTAGACAATGTTACAAGGTCTGCATGT
AAATGGGTTGCCTTATTATGGAGAAAAAAAATCACTCCCTGAGTTTAGTATGGCTGTATA
TTTCTGCCTATTAATATTTGGAATTTTTTTTAGAAAGTATATTTTTGTATGCTTTGTTTT
GTGACTTAAAAGTGTTACCTTTGTAGTCAAATTTCAGATAAGAATGTACATAATGTTACC
GGAGCTGATTTGTTTGGTCATTAGCTCTTAATAGTTGTGAAAAAATAAATCTATTCTAAC
GCAAAACCACTAACTGAAGTTCAGATAATGGATGGTTTGTGACTATAGTGTAAATAAATA
CTTTTCAACAAT
atttttgttgcagaaatcatttctgaaatacttactgggtgggaattaaacagtcattca
gtctctgtgggaatattttttaaaaacagcactaagcaccagtgaaaatgctttgaccaa
accatggtctccagatcttctttgctagcctgtggacaccaaccccaaagcaggctccat