Gene AKR1C4 Variant 1
DNA : 22.11 KbNT_077567
mRNA : 1194 bp NM_001818
CDS : 972 bp NP_001809
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  117 bp
gtaaaaattctctttgataagaaacgagtgaactggattcaattttcctcacagcctgtg
taatacaccatcacttgcttcctcctacatgccattgattagccccagggagcagtgcag
cactgcctgcccatgttttacataacccctgaatataaatgccagatgttgctgaaggaa
ACAGGATCTGCTTAGTGAAAGAAGTGGCAAGCAATGGATCCCAAATATCAGCGTGTAGAG
CTAAATGATGGTCACTTCATGCCCGTATTGGGATTTGGCACCTATGCACCTCCAGAG
gtaataatcacattttcagcattgagcatttaaaagagcaaagctagaataagtgaacga
tgacctgggttgttcagctttgtgtttctgttaccctgagtgactcacgtggtctgtctt
actgggctagagctattctatgttcaaagagaaaaggtagtcaatgtttgttttgcactg
EXON 2  168 bp
cgggtcatagtcccacaacctgcccccatctgtatgctcccctagaggtctgagcagcgg
gggcctgaagaagcgagccacacccccactgcacaccctgtgaggacaagggaacttttc
ctgtttcactacctctcaagcacattgatcaccaaatactacctttcgttgctccttcag
GTTCCGAGGAACAGAGCTGTAGAGGTCACCAAATTAGCAATAGAAGCTGGCTTCCGCCAT
ATTGATTCTGCTTATTTATACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAG
ATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAG
gtactgtgcctatgatgagcatgtatgcacatgtgtttaatgggattgtgtggagatgac
aattctgtaactggttcagtagttgtgggtgaattgtgcttattagttccaatttattca
cacatattcaggtattaaagctaaaataaaaggcagagaatgatgatgcctttctcatca
EXON 3  117 bp
taactatatatgcaatatgtagctttcatataggtaggtcatatcaaaataaaacaaagg
gaatttttgccagaggtcatctgtttggaacggtgaaaaatgtctaaatattaggtgaag
caaactaataaaactagctcatgtttttattcaacataaatcctttattttaccatgcag
CTTTGGTGCACTTTCTTTCAACCACAGATGGTCCAACCAGCCTTGGAAAGCTCACTGAAA
AAACTTCAACTGGACTATGTTGACCTCTATCTTCTTCATTTCCCAATGGCTCTCAAG
gtagggaatttgtgagatcaacttctcttctgttctcagcatgaccatcctttatgatgg
ttgaattgaacttcttctaaggagggtgtaggtgttattacatggcagaagagtcctaag
tataatgcctaagccattttcttgaagagtacaaccttccttctgtaacgtatgatgaca
EXON 4  78 bp
gaagcctgtctcctaaagacattccttaaaactctgtacgtgaaacacttggcccacatc
actttctagaacatttcagcacctacctcacggtggattattatcctaaaatgtacatgg
gagcatgcctatgggtggaaaagttaaatggtgacactaaagtgactgcttctacttcag
CCAGGTGAGACGCCACTACCAAAAGATGAAAATGGAAAAGTAATATTCGACACAGTGGAT
CTCTCTGCCACATGGGAG
gtgagtgcttggaggacagagtacagaaaaggaagacaagaagaggtaaacctgttcccc
agctttcatatgcaacattggaatatgcaccattggaactagaaattaaggagcttgaca
aaggaagttttgctgagtggtagggaagaatacatgactgaaatagaatagcaggaaatg
EXON 5  123 bp
tacacaaattcttcttgctgtcactatccttttgttatctgttgtaattttttctcttga
gaatcactgctattttcattgtcatatcttaacagttgttgctttaacagttctgtcttg
catttatcataatctgcagccaactgcacaaataattcctcacaacccctttctccccag
GTCATGGAGAAGTGTAAGGATGCAGGATTGGCCAAGTCCATCGGGGTGTCAAACTTCAAC
TGCAGGCAGCTGGAGATGATCCTCAACAAGCCAGGACTCAAGTACAAGCCTGTCTGCAAC
CAG
gtgagcaccctcagcctcctctcctttctcttctcaatgtccatcttcctgtcctactgc
ctggcttccatttgttttgttccacttacatttgtgaaacagaagattctagaaagcaaa
acatctgtctagaagaaaacggaagacccttaattgcacctcttcttggagaagtcttaa
EXON 6  110 bp
taacatttctatatatacttttagaccagtaatataaactgtatttttataaaatgattg
ttacttgacagtaatattctgttcaaatttaatgttatactttattcagcttattttaat
ctttatattaacatatctgttttgaattatctgatgcttttctctcttgatcatctaaag
GTAGAATGTCATCCTTACCTCAACCAGAGCAAACTGCTGGATTTCTGCAAGTCAAAAGAC
ATTGTTCTGGTTGCCCACAGTGCTCTGGGAACCCAACGACATAAACTATG
gtaataagagcatcaggaagtttacctaaaatgccattttgatgaaaaattttagttata
gcatactcagtctcctagagttcattctcaatgggtcagggtaaggggataatttgcatt
tcttatgagataccaggtgatgctgctgctgttcagggacctcacttgagaggctctggt
EXON 7  166 bp
caatgggtcagggtaaggggataatttgcatttcttatgagataccaggtgatgctgctg
ctgttcagggacctcacttgagaggctctggtgcagaatgaacaccttagtctgtttagg
gagcctcctaccaaactgaatccagcctcaagacttcagcatttctggctttccttccag
GGTGGACCCAAACTCCCCAGTTCTTTTGGAGGACCCAGTTCTTTGTGCCTTAGCAAAGAA
ACACAAACAAACCCCAGCCCTGATTGCCCTGCGCTACCAGCTGCAGCGTGGGGTTGTGGT
CCTGGCCAAGAGCTACAATGAGCAGCGGATCAGAGAGAACATCCAG
gtgaggagttgggtgggcatcagggctcctgcacagtgtccttcacacgtgtgcttcttg
taaggttctcaggacacccttggactaagtccacttcctgggcatttcctatgcacaaat
gctttgtgtgcataagtgttttctactctaccacaggaggggcagcatgggtggagagaa
EXON 8  83 bp
atttatattttatctgatattctttaatcacttgagagtttagagatggtctttcataac
ttttggaaacttatcaagtattttacatattgcctctacaccctactgtgtgatatactt
ggctattccaagttgacaattatgcaatctaagaataaacattttctacttctttggtag
GTTTTTGAATTCCAGTTGACATCAGAGGATATGAAAGTTCTAGATGGTCTAAACAGAAAT
TATCGATATGTTGTCATGGATTT
gtaagtaactttggaaaatgggtttcccagtttatttttagaggaggaatgtcagatggg
tgttgaaagtgacctcaataccagggagacagaggccagtgcaagtgagaggtgagacag
gaactctctggaactctccttctggattcactccagagctctgttctctgacagggtgag
EXON 9  232 bp
ttttgaaaaaaaaaaaaaacacattataaactcatgttcatgaaagacattctacaaata
gtccgaaaataaacttcttaacattcacactaatggcagcttcatataaattcactttgc
taccagctttttaatagagtcatttcatccatatttatgtactatcctttctcttttcag
TCTTATGGACCATCCTGATTATCCATTTTCAGATGAATATTAGCATAGAGGGTGTTGCAC
GACATCTAGCAGAAGGCCCTGTGTGTGGATGGTGATGCAGAGGATGTCTCTATGCTGGTG
ACTGGACACACAGCCTCTGGTTAAATCCCTCCCCTCCTGCTTGGCAACTTCAGCTAGCTA
GATATATCCATGGTCCAGAAAGCAAACATAATAAATTTTTATCTTGAAGTAA
ttgaatgtttttccttaaagattcttttcctactcctttctctgttacttgtgtgtttct
tttccttctagttctttaaggccaaaaactgatttgcctataagtttggggcagagagca
gatgataaccaatattttatagacatttttgaggtgagagtaggtggagttttcagcctc