Gene AKR1C1 Variant 1
DNA : 14.54 KbNT_077567
mRNA : 1215 bp NM_001353
CDS : 972 bp NP_001344
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  103 bp
ttatgaattttcttaggtaagaaacggttgaactggatgcaatttttatcacagcttgtg
taagactgcctctgtccctcctctcacatgccattggttaaccagcagacagtgtgctca
ggggcgttgccagctcattgctcttatagcctgtgagggaggaagaaagaaacatttgcc
AGCCAGGCTAGTGACAGAAATGGATTCGAAATATCAGTGTGTGAAGCTGAATGATGGTCA
CTTCATGCCTGTCCTGGGATTTGGCACCTATGCGCCTGCAGAG
gtaacaataatatttttagtgttgagagttcaaaggagctagagtaagtggaagctgacc
aggttgtcaggcttgtgttcctatgttactctgcatgactcccctttaaacgtcagtctt
tgttctgcaatgccatcttgtcacagggtcatctactgcttatttgtggcactgttttgt
EXON 2  168 bp
tgcccaacctttattactaactgggaaagacccagggagactgggatgggctcatgattc
tacatacagaactcatccaagaaaggaggaaaagctgatttttgtgaacgtcgctacttg
tgcctgaactaactctcaggcacattagtcagaaaatactacctatggttactcccccag
GTTCCTAAAAGTAAAGCTTTAGAGGCCACCAAATTGGCAATTGAAGCTGGCTTCCGCCAT
ATTGATTCTGCTCATTTATACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAG
ATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAG
gtactgtgcctatgatgagcttgtgtgcacatgtatttattgtgattgtgtggaggtggc
agttctatgactggatccatagtatagggtgaattgtgcttatttattacgatttattca
cacttactcatgtattaaaactaatatcaaaggcaggaagtgaagatggctttctcatct
EXON 3  117 bp
acatattataaagttcatcatgatatggcagaacaaaaggcatcacaagaagagagagaa
taattttgcctgtggtcattagttttgaagtagtagaaaatgtctaaatattaggtggag
caaactagtaaaattggctcaagttttcattacacaacttcctttctctaacctctgcag
CTTTGGTGCAATTCCCATCGACCAGAGTTGGTCCGACCAGCCTTGGAAAGGTCACTGAAA
AATCTTCAATTGGATTATGTTGACCTCTACCTTATTCATTTTCCAGTGTCTGTAAAG
gtaggcagcttgtgtgatcaaattaatttcacttttgttctcagcataaatattgttttt
atggatatttgaactaagcattttcttaggaggacatagggattataacatagaagaaga
atcctaaatctaactcctaattcctttctatgggatacattttgaatccatacttccgtg
EXON 4  78 bp
gcctgtcacctgaagacattccttataccttcatatgtagtacactctgtacataccact
ctctggagcactgcatcacctacctcatggaggattagtgtccttaaatgtacctcagag
catggctatgtgtggagaaattgacttgtgacatcactaaactgactgcttctacttcag
CCAGGTGAGGAAGTGATCCCAAAAGATGAAAATGGAAAAATACTATTTGACACAGTGGAT
CTCTGTGCCACATGGGAG
gtgagtgtttggaggtgagagaacggataagaaagatgaggtaggatacatctgtttcct
atcttcttagtacaagtatggaaaatgcaccattggatcaaaaacttaggaactttacaa
aggtagtttttgtgagcagtgaggaaaaagaaatgacaggcatacaaaagagagaagtgg
EXON 5  123 bp
aggaaacagaaatacttactcttgcaatcactatcttcttccccaattttctgttttatt
ttttcccttttaagaaccacggctagctagttttattgtcatatctagacagttgttact
ttcacagttctgtgtcacatttatcttgatcttccacacctcacaattcctttttcccag
GCCGTGGAGAAGTGTAAAGATGCAGGATTGGCCAAGTCCATCGGGGTGTCCAACTTCAAC
CGCAGGCAGCTGGAGATGATCCTCAACAAGCCAGGGCTCAAGTACAAGCCTGTCTGCAAC
CAG
gtgagcaccctcagcctcctctcctttctgttcttcatgcccctctttctgtcctattgc
caagtatccattcatttagtcccacttatctttgtaaaagagaagattctagagagcaaa
gactctgtctcgaagggcatagagggatcttacttgtacccggcttagaaaagtcttaga
EXON 6  110 bp
ttctattttcttaggagagaggggcataaaatttatttttatgaaaaagatcatttttga
caataatattctcagttcaaatttaatgctctacattattcagcttcttttactttggtg
attttaatattagtgtaacttttggattatctgatgcttttccatcttgctcgtctgcag
GTGGAATGTCATCCTTACTTCAACCAGAGAAAACTGCTGGATTTCTGCAAGTCAAAAGAC
ATTGTTCTGGTTGCCTATAGTGCTCTGGGATCCCACCGAGAAGAACCATG
gtaataagagatacaggaagtttacctaaaacaccggtttgataaaaaaaatttaatcag
atcatgctgtttcctggagttcactcacagctgacttggggtgagggaagaatttgcatt
tctgacgagatcccaggtgatgttgaggctgctgttcgggggcctcgcttgagaagctcc
EXON 7  166 bp
acttggggtgagggaagaatttgcatttctgacgagatcccaggtgatgttgaggctgct
gttcgggggcctcgcttgagaagctccggtgcagagtggacgccttagtctgtttaggga
gccgcctaacaaactgtatccccagcctcagggcctcagcctttctgcctttccttccag
GGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTCCTTTGTGCCTTGGCAAAAAA
GCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAGCTACAGCGTGGGGTTGTGGT
CCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAACGTGCAG
gtgaggagcggggctgtgggcctcaggtctcctgcacagtgtccttcacacgtgtgcttc
ttgtaaggctctcaggacagccttgggccagctccatttccctgtatttcctatgcatga
actctttgtgtacgtcataagggtttcttctactctagcacaggagaggcaacagaggtg
EXON 8  83 bp
gcttatttttgactggttttcattgaccacttgggtgtttagagaggtctttcataaatt
ttggaaacgtatcaatcttttaagtattgtctctgcaccctactgtctgatgaacttggt
tgttcccaattggcaatgatgtaatctaaaaataattaaagttttctattactttgatag
GTGTTTGAATTCCAGTTGACTTCAGAGGAGATGAAAGCCATAGATGGCCTAAACAGAAAT
GTGCGATATTTGACCCTTGATAT
gtaagtaattttggagatggttgtcctaatttattttcagaggaggaacgtaggatgggt
gttgagagtgacctccacaccaggggcacagaggccaacgtgagacagaggtgagacagg
agctttctggaagtctcctcctggattcactccagagctctgttctctggcagggagagt
EXON 9  267 bp
tttgaaaatacagatatgataaagtcacattcattaaacaaagaaacacagattctagag
cagtcagaaaatgaacttcttaacatctacactagcggcagcttcctagaaatcactgca
ctacccgctagtaacggagtcattgccattcagagtgtgcatttttttttctctttccag
TTTTGCTGGCCCCCCTAATTATCCATTTTCTGATGAATATTAACATGGAGGGCATTGCAT
GAGGTCTGCCAGAAGGCCCTGCGTGTGGATGGTGACACAGAGGATGGCTCTATGCTGGTG
ACTGGACACATCGCCTCTGGTTAAATCTCTCCTGCTTGGTGATTTCAGCAAGCTACAGCA
AAGCCCATTGGCCAGAAAGGAAAGACAATAATTTTGTTTTTTCATTTTGAAAAAATTAAA
TGCTCTCTCCTAAAGATTCTTCACCTA
ctttggtctccataacttctatgttttctttccttctgacacactagtgcccctaaattg
tgatttgcctatacgtttagggccggggttggaagatgttaacaaccatttaagattcat
ttctgcagtgggagtgggtggagtttcaccctctgggaaaggggcaggtgacaggtattt