Gene ADRA2A Variant 1
DNA : 3.65 KbNT_030059
mRNA : 3650 bp NM_000681
CDS : 1353 bp NP_000672
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  3650 bp
ttgcttgatcctggggctataaaacgagtccaccgtgagcgcagcggagcagcagcagct
ccagctcggtgcagaagcccagcagccggcgtgccgccgcccggccactccagcgccttc
ttccccgccttgcgctcctgccccaactcgcgctgtcgtcggaccccggcccatccagca
GCGCTCGGCGCCCACCAGGCGGACGCCCAGGAGAACCCCTGCCTCCGTCGCGGCTCCTGG
AGAGCTGATCGTTCACCTGCCCCGGCCCGCCTGAGGACGGGGGTGCCTTCATGCGGCCCC
CACACTCCTCACCCCGCCGCCGCCGCCGTCCCGGAGCTCCGCACAGTGTGCCCCAGCCCC
AGCAGGGCGCACAACTTTGGAAGTCTCGCGGCGCTCCGAGAGGCGGCAGAGTCCGCGCCC
CAGCCCCGGGCCGGGCCGGGCCAGAACCGCAGCGTCTGGGGGAAGCCAGAGAGTCGGTAA
TCGCTTCGGGGATGTAAGGCGACAGACATAGGACCCCCGAGCTCGCATCAGCACCCTTCG
GCTGCCTCCCGGGGTGGGGGCGGGCCCCGCACACGGTAAGACCTCTTGCTTTCGCTCAGG
CTCAAGATTCAAGATACAGATATTGATATGTATATATATATTTAATTTCCTGTCATCCTT
CCAAGTTATCAGGCCACCGATGATTTTTGTTCTCCCTTCTTGAAGAATAAATCTCTCTTT
ACCCATCGGCTCTCCCTACTCTCTCCCGCCGCTTAGAAATAAAACTTGGCTGTATTAGGA
GCTCGGAGCAAGAAGGCGCCCACCGAGAGCGTCTGAAGCGCGAGCCAGGCGCAGTTCGCG
GGACCCGGGCCATGGGCCGCTAGCGGTCCTCCAGTTCGGGCCCGGCCTCCCTGCGGCCCC
CTCCCTATGTGAGCCGCAGCCAGGCGAGCGGGGCGCCGGAGGAAGAGGAGGACCCACGGG
CGCCGGGCCGGAAGGCAGCTGGCAGCAGGCCCAGGCCAGCGGGCGCCCGCGTTCATGTTC
CGCCAGGAGCAGCCGTTGGCCGAGGGCAGCTTTGCGCCCATGGGCTCCCTGCAGCCGGAC
GCGGGCAACGCGAGCTGGAACGGGACCGAGGCGCCGGGGGGCGGCGCCCGGGCCACCCCT
TACTCCCTGCAGGTGACGCTGACGCTGGTGTGCCTGGCCGGCCTGCTCATGCTGCTCACC
GTGTTCGGCAACGTGCTCGTCATCATCGCCGTGTTCACGAGCCGCGCGCTCAAGGCGCCC
CAAAACCTCTTCCTGGTGTCTCTGGCCTCGGCCGACATCCTGGTGGCCACGCTCGTCATC
CCTTTCTCGCTGGCCAACGAGGTCATGGGCTACTGGTACTTCGGCAAGGCTTGGTGCGAG
ATCTACCTGGCGCTCGACGTGCTCTTCTGCACGTCGTCCATCGTGCACCTGTGCGCCATC
AGCCTGGACCGCTACTGGTCCATCACACAGGCCATCGAGTACAACCTGAAGCGCACGCCG
CGCCGCATCAAGGCCATCATCATCACCGTGTGGGTCATCTCGGCCGTCATCTCCTTCCCG
CCGCTCATCTCCATCGAGAAGAAGGGCGGCGGCGGCGGCCCGCAGCCGGCCGAGCCGCGC
TGCGAGATCAACGACCAGAAGTGGTACGTCATCTCGTCGTGCATCGGCTCCTTCTTCGCT
CCCTGCCTCATCATGATCCTGGTCTACGTGCGCATCTACCAGATCGCCAAGCGTCGCACC
CGCGTGCCACCCAGCCGCCGGGGTCCGGACGCCGTCGCCGCGCCGCCGGGGGGCACCGAG
CGCAGGCCCAACGGTCTGGGCCCCGAGCGCAGCGCGGGCCCGGGGGGCGCAGAGGCCGAA
CCGCTGCCCACCCAGCTCAACGGCGCCCCTGGCGAGCCCGCGCCGGCCGGGCCGCGCGAC
ACCGACGCGCTGGACCTGGAGGAGAGCTCGTCTTCCGACCACGCCGAGCGGCCTCCAGGG
CCCCGCAGACCCGAGCGCGGTCCCCGGGGCAAAGGCAAGGCCCGAGCGAGCCAGGTGAAG
CCGGGCGACAGCCTGCCGCGGCGCGGGCCGGGGGCGACGGGGATCGGGACGCCGGCTGCA
GGGCCGGGGGAGGAGCGCGTCGGGGCTGCCAAGGCGTCGCGCTGGCGCGGGCGGCAGAAC
CGCGAGAAGCGCTTCACGTTCGTGCTGGCCGTGGTCATCGGAGTGTTCGTGGTGTGCTGG
TTCCCCTTCTTCTTCACCTACACGCTCACGGCCGTCGGGTGCTCCGTGCCACGCACGCTC
TTCAAATTCTTCTTCTGGTTCGGCTACTGCAACAGCTCGTTGAACCCGGTCATCTACACC
ATCTTCAACCACGATTTCCGCCGCGCCTTCAAGAAGATCCTCTGTCGGGGGGACAGGAAG
CGGATCGTGTGAGGTTTCCGCTGGCGCCCGCGTAGACTCACGCTGACTGCAGGCAGCGGG
GGGCATCGAGGGGTGCTTAGCCCCAGGGCACTCAGAAACCCGGGCGCTGCCTGCTCTGCG
TTTCCTCGTCTGGGGTGGCTCTGCAGCCTCCTGCGGGCGGGCGTCTGCTGCTCCTACAAG
GGAAGCTTCTTGCTGCCAGGCCCACACATCCCCAGTTGTTGGTTTGGCCACTCTTGACCT
GGAGCCATCTTCCTAGTGGGCCACCCCTAATCACTATTGCTTCCTAAAGGTATTTTCACC
CTCTTCGCCTGGTACAGCCCTCACAGCTCTTCAGAGCAAGCACTGGACTACAAGGGCATG
GCTCACAAAAGGTTAATGGATGGGGGTTACCTAGCCCTGGCTAATTCCCCTTCCATTCCC
AACTCTCTCTCTCTTTTTAAAGAAAAATGCTAAGGGCAGCCCTGCCTGCCCTCCCCATCC
CCCGCTGTAAATATACACTATTTTTGATAGCACACATGGGGCCCCCATATCTCTTGGCCT
TGGTTTTGATGTTGAAATCCTGGCCTTGGGAGAGATGCCTTCCAGGCAGACACAGCTGTC
TGGTTCAGGCCAAGCCCCTTTGCAATGCAAGCCCTTTCTGGTGTTATGAAGTCCCTCTAT
GTCGTCGTTTTCACCAGCAACTGGTGACTGTCCCTTCGACACGGACCTGCTTTGAGATTT
CCTGACAGGGAAAAGATTTCTGTCCATTTTTTTCCTGTGCCTAACAGCATAATTGCCTTT
TCCTATGTAAATATTATGATGGTGGATCAAGACATAAGTAAATGAGCCTTTCTGCCTCAC
ATCAGCCCTGTGTATAAAGCCATTATTCTCTGATGCACTGTTTGCCCCAGTAACTCACTT
TAAAACCTCTCTTTCCAGTGTTCCCTCTCTCCCTCCAGGGCCACTGCTTGAAGAAGAATA
TGTATGTTTCTATCTTGTATGTCTGTGTGCCCCTCCTGCCCCGAAAGTGCTGACTATGGG
GAAATCTTTTAGCTGCTGTTTTTAGACTCCAAGGAGTGGAAATTATGTGGAAGAAGCAAA
CCTGATACAATTTGCCCAAGGTAAACAGTTTGAAAAGACAAATGGGCCTGCCAAACTGTA
CAGTTTCTTCCCCAAGAGCTGTTAGGTATCAAAATGTTGTCCTTTCCCCCCTCCGTGCTT
TTCTGGTTGAGATCATGTCATTGATGAACTGCCAAAGTCAGGGGAGGAGGGCAGAGACTT
TGTGTTTACATCTGCATTTCTACATGTTTTAGACAGAGACAATTTAAGGCCTGCACTCTT
ATTTCACTAAAGAAAAACTAATGTCAGCACATGTTGCTAATGACAGTGGATTTTTTTTTA
AATAAAAAAGTTTACAGATCAAATGTGAAATAAATATGAATGGAGTGGTC
ctcttgtctgttatctgagttttcaaaagctttaagactctgggaacatctgattttatg
gattttttaaaaataaaaaatgtacattataaaaattttttaaacgttccatcagtaaca
aagctaccatttactaagtgtttctgacatgctagacactgtggtgaactggttgtaggc