Gene ACTA2 Variant 1
DNA : 17.68 KbNT_030059
mRNA : 1330 bp NM_001613
CDS : 1134 bp NP_001604
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  24 bp
ggcctccggccacccagattagagagttttgtgctgaggtccctatatggttgtgttaga
ctgaacgacaggctcaagtctgtctttgctccttgtttgggaagcaagtgggaggagagc
aggccaaggggctatataacccttcagctttcagcttccctgaacaccacccagtgtgga
GCAGCCCAGCCAAGCACTGTCAGG
gtaagtggcgccaggccaaggatgtgacttatagattccagtggctcttttaattacccg
gtataataagacatcatctgcagggatttggctgggttcatgcactgatatttctgaatg
aagattgtactactaaaatgattgtagcttttggctttaatgatctaacgttaaagacag
EXON 2  152 bp
ctgaaagcttatagtgtaactaaagtacttccagatacatgctatattagataagggtca
gaggatagcactaggacacagaggagggcccccaaacccagccttggaggtgggagttgt
caggtaagtgccacaaatgcccaattacagctgaggctgcttcctccctgttttctatag
AATCCTGTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTG
ACAATGGCTCTGGGCTCTGTAAGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTT
TCCCATCCATTGTGGGACGTCCCAGACATCAG
gtgaggaaaattatgattggaacataacaggacacagattaggttcctctgtgttcatgt
ttatccccagattgtctatctctttctgcccagaagttatgtaaccttgttacaaataga
cctctaatgattaaggtccaggagtaaatgccaatttcacatataatgtagacagattat
EXON 3  129 bp
ttccaatcaactgcagaattttgcttaagagcatagtggcaatgagactcaatatgttta
ttgttgctgataatcagaagaggaacttcccatctcaatgacttaaccttttgtggcttg
gctgtaattgattcacaagttttgggagatgctgactcataatgtgttgaacctttttag
GGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAA
AGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGACGAC
ATGGAAAAG
gtatgggaggtttgctgcagcttgggccctcaggatgcataatccctgtgttctctgata
cagaacaccacactactgctggggaaataactggctcacattgctcaactgtacttttac
ttgttaatgttcattctgggttattacccattgaaaaaaaaatccttgtagccataaaaa
EXON 4  111 bp
gaaggtacttacacactttgagcttcagtctctgcatctataaaaccatggacacatgca
tgagtacttgtagcatttcctttggtcttggtttcaagtagcttctggtccctttttggg
aaatgcaggacctcatgacagcacatcattgtgtttctcctctgtcccccaactcactag
ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAGCATCCCACCCTG
CTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACTCAA
gtaagtatgctaccccagcacacaacactgtggggtctggggaaacttctgttagaagga
ggctatgcagcacagcagagagaaggccggagctaggagtccaccaacagactaacagcc
ttcagtgaactcagggatcccaaaggacaggaacagcttgaaagtacttgcatccttcct
EXON 5  85 bp
cattcacaccttcatttctcctctttaacgtgaccagggctgttctgaacctccttactt
tggcctcctctgcccagaacaggtcaggcccctctgcatccatcaaccaggtgtgctctc
ctgaccattctttgtcagatgggcaccttcactaactcagctctttggattgctttgcag
ATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTGTCT
CTCTATGCCTCTGGACGCACAACTG
gtaggtggctgggcgggacagcaagctggttggagcgcactgccagagatgggattgaat
ggtcgttaacacgtgggggtgacggactggagttgagttagaatggacacggctgaaccc
agccctaaaagatcttcttctagtgttcaaaataagcccttgatctcatatttctagcag
EXON 6  162 bp
tactttttttcatcttccccgagccctgtcccacctcacctctcctatcacatgccctgt
tttctctttttaaataagaggctcggaaattccctctcccccaaggcttccctctacttg
tccagcaagtaaccacatgccagctgccatggtgacttatcacgcccaattgtctcccag
GCATCGTGCTGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATCTATGAGGGCTATG
CCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCA
TGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTG
gtgaggcctgtgggagataagggggagaggggagcagtgtgttgctcagtaacttccagg
accatcctcactatccaaggagatgatgggatgaagttttgcaaatggcaaggcctggct
ctaatgcacagagcaaagcacatctttctttgctgtgtgaagttgcaaaatgattacact
EXON 7  192 bp
aggtggttccctggtggccctactacgtcattatcattgtggattttggattgcagaata
ttgaactgacacattttttgatggcacatgtcttgagggagagactgcagtagggcaggt
gaatctttgccacctgtgcagaccctaatgtttgccacaatgtttgtatctggttgacag
CTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTG
AAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTG
ATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGC
CATCCTTCATCG
gtaggcaacaaacgcccttttcctgggaaggggagtcattgtcttcttccatatcaagcc
agcctccagaacatggagacaagtgacggttgccccaagaccaaaagcatttctaaacca
gaaaaagggaaagtgccacattttcaaggcgagaagacataatgaggccaggaaaaaggt
EXON 8  182 bp
ggcaggaagacatagagcataacaagacccttttgtctctcagacaggtggttcctagat
tattatgtcttcccagcctcagtccactgcaagatcatccagatgttcaagtctggtctt
ccatgtctagcctgggttttactctccacttaaggaccatggcctgtgtctcttttccag
GGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTG
ACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTG
GCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCA
AG
gtactgttcagtgacagacccagtggcaatgccgccagcagtgtcagccctataaccaca
gataagaactcttcagagactgtattttggtgacatgcaattgtgggttttaggggtagg
taatggacacaaatctcatattttacaggatgtaagtcaatctagttcataagaaaaatt
EXON 9  293 bp
tctggcggtcctgccaagaacatgacacaattaggacacaattggcatctaacagacaag
cctgtgtccctgctgaacaagaaactaggccatggtagaacatccaggctctgtcctacc
gcactaacgactgcactaatgatgacattaatgaccattctttttcatcttgactgacag
ATCATTGCCCCTCCGGAGCGCAAATACTCTGTCTGGATCGGTGGCTCCATCCTGGCCTCT
CTGTCCACCTTCCAGCAGATGTGGATCAGCAAACAGGAATACGATGAAGCCGGGCCTTCC
ATTGTCCACCGCAAATGCTTCTAAAACACTTTCCTGCTCCTCTCTGTCTCTAGCACACAA
CTGTGAATGTCCTGTGGAATTATGCCTTCAGTTCTTTTCCAAATCATTCCTAGCCAAAGC
TCTGACTCGTTACCTATGTGTTTTTTAATAAATCTGAAATAGGCTACTGGTAA
cttcttgcgttggcctccgatcaatactcgactgataccatttgttaggttgacctcacc
cgttacaggatggctccctctagtggtccagctgagcacatggcaattaggatggatatg
tttctcaggcaaagggtagaatcacattacctgaagtggggagctgcacttcggttctgt