--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (38608 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1714       1834   0    Initial    121    99   Excellent
ctcgtggggacgcgctcgaggcaggtgagccgaggctggggcgcccgggggtgtccccgg
atgccggtgcgcgcggctccctgacccgcccttccgcggcctgggggacgggagaatggg
gggtccacggccgccttgggtcctcaccgcgcaccgcgcccgcagcggagccccggagcc
ATGGCCCTGAGCGAGCTGGCGCTGGTCCGCTGGCTGCAGGAGAGCCGCCGCTCGCGGAAG
CTCATCCTGTTCATCGTGTTCCTGGCGCTGCTGCTGGACAACATGCTGCTCACTGTCGTG
G
gtacgtgcggacagggcacccctgccccggcaccccagccccagcgccccttccccggca
ctccacttacccctgcgcggtcccggagctccgccaaggcccgggaaagttggagaactc
gctttgcaaaaaagacatcccctccaggctgccgcgccggggctaggaggagccgcgttg

Exon  2 +       3991       4337   1   Terminal    347    90   Excellent
ggccagcctggtctcgaactcctgacctcaggtgatccacctgcctcagcttcccaaagt
cctggaattacaggtgtgagccactgctccctgccgacacaaccatagttttttgctggc
ttttttcctggagagggtttcagtgtgatcaccaccttgccattctgctcttatccccag
TCCCCATCATCCCAAGTTATCTGTACAGCATTAAGCATGAGAAGAATGCTACAGAAATCC
AGACGGCCAGGCCAGTGCACACTGCCTCCATCTCAGACAGCTTCCAGAGCATCTTCTCCT
ATTATGATAACTCGACTATGGTCACCGGGAATGCTACCAGAGACCTGACACTTCATCAGA
CCGCCACACAGCACATGGTGACCAACGCGTCCGCTGTTCCTTCCGACTGTCCCAGTGAAG
ACAAAGACCTCCTGAATGAAAACGTGCAAGTTGGTCTGTTGTTTGCCTCGAAAGCCACCG
TCCAGCTCATCACCAACCCTTTCATAGGACTACTGACCAACAGGTAG
ggcagactactttagtcaaagagtttgatatttgtatcagtcctagcttatgtccttcct
ggaattctgcttcttactcattggtgagagtctggaaaatccatggtgggtgagctgggg
aaaacccagtccccttcccctatgtctctgttcccagataaccacaatttcctattctat

Exon  3 +      10323      10369   0    Initial     47    94   Excellent
gaggggccagaagagtttgagaacggagacccaggagcttcccagggagtcttctttgcc
ttgaagccgagctctggggaaaaatgatgcccagcgcttaccactgagcagcccatgcag
tggcttggcctgtgttgaaagtgcaggcacaggtgtgtccggtactgaggaggcggcaac
ATGAGCCTGGTTGTATCTGAAGCCATTGGCTTGCTCTGCAGCCATGG
gtgagccactctgtctctgaacctcagctttctcatctaaggtgagggtttggactggct
agcccttgagtttccttctagctgtgatattcgtttattccatacgtgcattgttaaaat
cccaaagaaaattaaaaagaaaaacagtagctgcagtgtttctaaagaaaacacagtacc

Exon  4 +      13419      13477   2   Internal     59    50    Marginal
cgttccaagacagtcaaacacaaaaaggtcacataggaagcactgagtatatgaattttc
agaaaagtccaccaaacacttatctgtctgatcccaaagggtagccaggcgaaaatcaat
ataaagccttaaaaaaatagcctgcagtcaccagatttgtctgatgtttgtgttttgcag
AATTGGCTATCCAATTCCCATATTTGCGGGATTCTGCATCATGTTTGTCTCAACAATTA
gtaagtgtgtggtgttttccttctgagtgtgggtctcatcagggtgggcattgatgccca
tgagccgggaattaacaatacaacctaaggacggcgggggggcggggggggtcgtggttg
gctcatgcctgtaatccgagcactttgggaggctgaggtgggcggatcatctgaggtcag

Exon  5 +      14068      14151   1   Internal     84    96   Excellent
aggtttgtgtattggcaacaattgcagaaaggaattgatagctttttacggaacaaaagc
acagggtggctaacatgcaaatgctccactgggttaaggggggcttctgaaacgttcctg
tttgggacggttgtgtcccagcagcactgatgtgcggtcttggaccccctctctcggcag
TGTTTGCCTTCTCCAGCAGCTATGCCTTCCTGCTGATTGCCAGGTCGCTGCAGGGCATCG
GCTCGTCCTGCTCCTCTGTGGCTG
gtaggtgtggaatgcctgagtgagttcgtgaggggccccttgcagagtgagctggactca
ttcagggaattcaggtattggtggtggttggggtgctggggattcttggagaaggcaccc
actttcctcttgggttctgcttggtcttacattttagtgaatctgacaggtttgggaaga

Exon  6 +      14425      14517   1   Internal     93   100   Excellent
tgctggggattcttggagaaggcacccactttcctcttgggttctgcttggtcttacatt
ttagtgaatctgacaggtttgggaagatcacaaggctggctggagagggaaggcgagtca
cgcattattcttttgctgttccccggagctggcctgttgactatttctttccctgtgtag
GGATGGGCATGCTTGCCAGTGTCTACACAGATGATGAAGAGAGAGGCAACGTCATGGGAA
TCGCCTTGGGAGGCCTGGCCATGGGGGTCTTAG
gtgggtaaggcccccgtgtaggcaaactggcaagaggggcctgcctggtgctggacagcg
gcagtcctcgcccagtgaccctggcgcagtttgcactgacacagaggtcccctttttatt
tttttcctttcctgctttcatggagactttgaaaaatggtaggaagagccctgagctggg

Exon  7 +      15297      15386   1   Internal     90   100   Excellent
aggcacttggaggaagttgccaagacaactgaactctaaccgaacagaacaatagggcag
ccaccccaaagccttattggaacaaagtagagagagaaacacaagagtcaaatagatggt
tctagtacagggagagggcatgtgtcccaggggtggtgtccccactttctctccctgcag
TGGGCCCCCCCTTCGGGAGTGTGCTCTATGAGTTTGTGGGGAAGACGGCTCCGTTCCTGG
TGCTGGCCGCCCTGGTACTCTTGGATGGAG
gtgagtgagtccacgtgggcgccatgccatgaccttggcatcgtgctggcacgcgcttgg
gccacacctgctttctgaagaggggcttgtcttttttatttttattttttagctattcag
ctctttgtgctccagccgtcccgggtgcagccagaggtaagcggctgggaatgagggccc

Exon  8 +      15499      15542   1   Internal     44    98   Excellent
gctctatgagtttgtggggaagacggctccgttcctggtgctggccgccctggtactctt
ggatggaggtgagtgagtccacgtgggcgccatgccatgaccttggcatcgtgctggcac
gcgcttgggccacacctgctttctgaagaggggcttgtcttttttatttttattttttag
CTATTCAGCTCTTTGTGCTCCAGCCGTCCCGGGTGCAGCCAGAG
gtaagcggctgggaatgagggccctgggggagggggcatggtgctgcttctgacccgtgt
ttttttcttgacagagtcagaaggggacacccctaaccacgctgctgaaggacccgtaca
tcctcattgctgcaggtggggctctgtgggtcttctgagtcaggggaatgcgaggtgatg

Exon  9 +      15617      15677   0   Internal     61   100   Excellent
acgcgcttgggccacacctgctttctgaagaggggcttgtcttttttatttttatttttt
agctattcagctctttgtgctccagccgtcccgggtgcagccagaggtaagcggctggga
atgagggccctgggggagggggcatggtgctgcttctgacccgtgtttttttcttgacag
AGTCAGAAGGGGACACCCCTAACCACGCTGCTGAAGGACCCGTACATCCTCATTGCTGCA
G
gtggggctctgtgggtcttctgagtcaggggaatgcgaggtgatggccgcgtgctggagg
caggggtggatggccagggctgattttcgttttgctgctagaaatgttgggctatataaa
aaaacagaaaaggcaaagaggctacaagtcaaaggaaatggttttcttccgccattgctt

Exon 10 +      17817      17938   1   Terminal    122   100   Excellent
cgaccatgatgatgatgattatgataaacagcctttgctgtccccttgatatgcgattta
tcctttacttaatgaaagtagaagttgcggttatctgagctgtaggcgcatggagtctaa
ctgtgcctggaaatgagagaggaggcagaagccactacaaagccctttcctcccttacag
GCTCCATCTGCTTTGCAAACATGGGCATCGCCATGCTGGAGCCAGCCCTGCCCATCTGGA
TGATGGAGACCATGTGTTCCCGAAAGTGGCAGCTGGGTAAGGACTGGGGTGGGCTCTTCT
GA
ttcaagagcatttgtccccagggcagcctttgtccccagggcatccctgctgagttgccc
ttatggggatgataaagtgattgcttctgtttgactcttaatggggtcattgcttagggc
agccttggggtctgtttgttctctggtttatccatcatccctgaggggtgcagaactcac

Exon 11 +      26513      26630   0    Initial    118    77        Good
tggggtaattttaacatttttctttttgtttatctcacggttccctaattctttcaatga
ctgcgtcttacttctgtcggatgaaatcacacataagattgcaggtgctgagctcccagg
caggagctgtttgtattggcccacgtgtgaagcccaccaccagccagagatggaggcaag
ATGAAGCAGTTGATAGAGAAAGGACTTTCATTTCTGGAGTGTCTCAGCAGCTTTGTGTGG
AGGATAAGCCACGTGGGTCCAGACCGGATCCGGCAGGCGCCGGATATTAGCTGCTGGG
gtgtgggccccggggcttcgttttatctgctctcatcaacattgtggtgtctacagttat
tactttttctaacatatgactgatatcagcactgataaggtctccttttcataaatttac
aggcgttgccttcttgccagctagtatctcttatctcattggaaccaatatttttgggat

Exon 12 +      28733      28827   0    Initial     95    63    Marginal
ccccttgccattctgcaggtctggcagagttgcaggttgctaactgtacggcccctggcc
tgcatccttttggtgcttccctgctttgctgttttctggttcacttgtccctcaccactc
agcacacctgcatgcctgacccacctcctgccagtcacacctgggccacacgcttagact
ATGGGTGTTTCCAAGGTGGAGAATAATAGGGGGGACCAGAACGCCCCAGAACTCCAAGGA
GTCCGAGAGATCATCTGGCCCTGCTCAGAAATTAT
gtgtgtgtatgtatgtttatgtgtgtgtgtgtgtgtatgcatgtgtatccatgtatgtgt
gtgttgtgtgtatgagtgtgtatgtgtgtgttgtgtgtatgtgtgtgaactaaaagaagc
taaaacacacatgcacacacatacatacacatacacactcatacacaaacacacacattc

Exon 13 +      30091      30233   1   Terminal    143    91   Excellent
cagaaaaggcttccttcattctttctactcaaagattagtatcaccccaagacttgcagg
tggtgatgacagaaggggaagagctggcagggtggtgagtttaagacacactccctgata
ttcggcccattttgggtttacatccgttttctatacactgtgttccctgactgtcttcag
GAATGGTGGATTCGTCAATGATGCCTATCATGGGCTACCTCGTAGACCTGCGGCACGTGT
CCGTCTATGGGAGTGTGTACGCCATTGCGGATGTGGCATTTTGTATGGGGTATGCTATAG
GTAAGGACATTGGCTTTTCATAA
gaaccttttacctcaatacgtaatggataacgtctactaaaattgtttaaatctttgcat
ctttcagtctacaagacatttggaagagctttatctaattctctgtttcctgaaaggtcc
ttctgctggtggtgctattgcaaaggcaattggatttccatggctcatgacaattattgg

Exon 14 +      37182      37286   0   Terminal    105    97   Excellent
tttagagtgtagaactacaggtcttttaggtcaggcgtctggcgattgctccaaatgact
ggttaatagcaagtaatactacatagttttcaaactaataatccttaaaaacagtaggtt
aaaaccatcttatctttatgaaacaagaagttaatatacttgcactttgctctcttttag
GCTATTCTCATGGATCACAACTGCCCTATTAAAACAAAAATGTACACTCAGAATAATATC
CAGTCATATCCGATAGGTGAAGATGAAGAATCTGAAAGTGACTGA
gatgagatcctcaaaaatcatcaaagtgtttaattgtataaaacagtgtttccagtgaca
caactcatccagaactgtcttagtcataccatccatccctggtgaaagagtaaaaccaaa
ggttattatttcctttccatggttatggtcgattgccaacagccttataaagaaaaagaa

--------------------------------------------------------------------------------