--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (78144 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5888       6013   0     Single    126    49    Marginal
ctgttaatgtcctaggggcagtgtgttcactcttttattctgagttaaacagaaggcaag
ccgggagcattgtgctttggacagagctgtgctgcattcttaggggacactggctataaa
tccagtctccctagaggttaacaatcaaagttctccccttattatagtcaggcgagtgat
ATGATGATGATAAATTGCTTGGACGTGACTGGCCCAAGCACTAGTGTGATGAATTATGTT
GTTCGGGGCATGACCGAAGATCTTCTATTGTCAGCTGGCAATGCTAAGTATTGGCAGTAT
TCATAA
atagccttttgccaatggtggtctctgctttacatattaaattctctgttttcacaggtt
gtggttcttagtcatctgtgtcctccactgaattcacttacataatcagccttttttttt
ttcctgttccctacttattaaacgggtgggatgtgctcacttgtgtatggtaaacactga

Exon  2 +      20229      20306   2   Internal     78    65    Marginal
ggaaggacagctaattttgtgtttgtaataggtttatactggattgctccacagcttgtt
ggtaaaagtaactttgagcacttagagaacacatctttatacttagtgtgttccaattta
aaaagtgttattactttttttttggaaaccgagcatctaagtaattctgagttctcccag
GCCAACAGAAACTGAGACAGGGAAAATGAACAACCATCATCCCCGGAATGCTGTGATTTG
CCATAACCAAGAAGGCAA
gtgagttttcacagtgcaaaagacgttgccagttgttcattcttctgttaatgctaccag
agagtacatattctaaatctgttcacctgtgttttgagactcaaagcagctctaaaatac
gtacattctttccagtcaagttcacttatccatccatccataaacatttacagaatcctg

Exon  3 +      36671      36814   0    Initial    144    46    Marginal
atttttatgatttagcatttatcccatgataaaactggaatcatgtatgcctcatacgga
ttgactgtgtccccacccacatctcaccttgaattgtaataatccccatgtgtcaagggt
ggggccaggtggagataattgaatcacgggggcggtttcccccatactgttctcctggta
ATGAATAAATCTCATGAGATCCGCTGGTTTTATAAATGGGAGTTCCCCTGTGCAAGCTCT
CTTGCCTGCTGCCATGTAAGTCATGGCTTTGTTCCTCATTTGCCGTCCGCCATGATTGAG
AGTCCTCCCCAGCCATATGGAATT
gtgagtccattaaacccctttcctttataaattacccagtctcagttatatctttattag
cagcctgagaacagactaatacagtccttctcccccaccatgttttggggtttatctgag
gataataattcctaataaatactttacttctttggcatttggacctctggacagcttttt

Exon  4 +      37949      38056   0     Single    108    46    Marginal
aaaaaaaaaaaaaaacagttagttctcctgtaagcattcctgtgtccttaatatcacttt
ctgttcctgccttgcatctccgcatctttttcttcgtctctggccgaatgctgtaaacgc
tcataaatatcaagtaataagatgcaaagagattgcaaactaaaactgaaaaccttaaag
ATGCAGTTTGTCATGAAGCTGCTGAAAGAGATATTGGAGAAATGCCAAAATACCTCCAAA
GCCAAAGTCTGGCTGTGTGACTGTGGAGCATTTAAAAGCTTCTCATGA
cttagtttcctcacttgaaaactggaataatatctgcctgattaaccacatgaaatttga
aataaaaagcaagtaaaatgatacctaaaagcactacttaaataataaagtacctggccg
ggcaccgtggctcaggcctgtaatcccagcactttgggaggcctaggtgggcagatcacg

Exon  5 +      46787      47022   1   Terminal    236    45    Marginal
ctttctctgaaaagaaataatctaggatatacgtgaatagttcctagaattcgcaaaaca
aagctactatttgttgaatatggtctgcgtgccaaatgcatctacaggtatttttacctg
tggtatctaatttatttttacgacagtctatgaaatgtgcttcgttattttaatttacag
ATGACAAAAATGGAAGTCAAAGAAGGCTTTCAAGGGATATGGGGGAAATGATGACTTCAG
AACACTATTTGAAGGAACAGTTTGAGAGCTTGGAAACACGTGATGCTCCTTTTCTTCAGT
TCCCAGAGTCTGGGACTCGAGTCCTGATTTTGCTCTTGGCCATGCAGGAGTTTGTCCTCA
CTATTTTCAGTAGCTCTTGTTCCTTTATAAACCCTTCATTTAGGAAATGTACTTAA
aatttttttttttgagacataatctcgctctgtttcccaggctggagtgcagtggcgcga
tctcggctcactgcaacctccgcctcctgggttcaagcaattcttctgcctcagcctccc
aagtagctaggattacaggcacgctccaccacacttggcaaatttttgtatttttagtag

Exon  6 +      48573      49052   0   Internal    480    53    Marginal
ttagatctgcagtggggatagattctgaagtcggcaggattgtgagatcgtatctctagt
tttattgatttgccttcttacatgggtatatgttcacagcctcccaccccttacggacaa
gagtttatgtgtgtgttaaatattctgattgtagttgtttgtttgtttgtttgtttttag
AAAAAAGAAATCCTCTTTTTAGAACATCTCTTGGTGGTACCATCAGAAATGTCTTCCTTA
AGTGGAAAAGTCCAAACCGTTTTGGGCCTTGTAGAGCCAAGCAAACTGGGCCGTACCCTG
ACCCATGAACACCTGGCCATGACCTTTGACTGCTGTTACTGTCCACCTCCCCCGTGCCAG
GAAGCTATTTCCAAAGAACCTATCGTGATGAAAAATTTATATTGGATTCAGAAAAACGCC
TATTCCCATAAAGAAAACCTTCAATTAAATCAGGAGACAGAAGCCATAAAGGAAGAACTG
TTGTATTTTAAAGCTAATGGTGGAGGGGCTTTGGTGGAAAACACAACCACTGGGATTAGC
CGAGACACACAGACGTTGAAGAGGCTTGCAGAAGAGACTGGCGTCCATATCATATCTGGA
GCCGGGTTTTATGTGGATGCAACTCACTCCTCAGAGACCAGGGCCATGTCAGTGGAGCAG

gtaaaaagcctaagttctttgacagtatttgttcataaattcagaacagccagaaccttg
gaaatgccctgggttcagaggtagctgggcatgctacggaaatttgctagctagcaaaga
catctgccagttggggccccagttagtaacactgtatttcataaagaaagtgccaatttt

Exon  7 +      50588      50738   0   Internal    151   100   Excellent
gttgatttttgatttggccagcaaaatgcctttttccttggccaatattaattgataaat
actgaatacatttttaaaagaatgaatgacaaaataaataaattcattcacatactgtgg
tggatctattttgataaatttcacaacctataaaatatattccttctcactcttccttag
CTTACCGATGTCCTTATGAATGAAATTCTCCATGGAGCTGATGGAACCAGTATCAAGTGT
GGCATTATTGGAGAAATTGGTTGCTCCTGGCCTTTGACTGAGAGTGAAAGAAAGGTTCTC
CAGGCCACAGCTCATGCCCAGGCTCAGCTTG
gttgtcctgttattatccatcctggacggagctccagggcaccatttcagattatccgaa
tattgcaagaagcaggcgcagacatctccaaaacagtcatgtcacacctggataggtaag
taggctgtcttacaaatggatgcaaactgccatataattaatgcatgatcaaattaagaa

Exon  8 +      63023      63209   1   Internal    187    64    Marginal
caagaagtattcatggatatagaatgcagaatgaggaaaactggctgaggttagcacctc
cactcttctaagatgtgctatgagatcattggtgactgggagggacaggacctctgttta
atcctcatctgctggatggcacacagagttcattttcccatggtaatatactgacattag
GGGTCAACCCTCTCCAAGTGAAAAAGAAAGTCACTTGCATAAATGCAACTTCAGTAGCGC
TTTGGCAGTCCCTGGAAGCCATCCAGCTGAATGTCAATTTCACATGGGTAAGTCACCTTG
TTAGACGTTCACGGCGCAAGGTGCTTGTTCCTAGATGTCACTACGATGGTGAGTGTGTCT
CCGTAGT
gtgagtgccttggaggaggaacggagttgccctggtgcctgggtgttcttacccctggag
gggcagcctggtttaagaacacggcctcaacacaaaagcagtttgggtttgtttgaagct
cttcaggttgagacctgagtttatcttttctgagacttaaagtcctcatctgtaagatgg

Exon  9 +      69256      69400   2   Terminal    145   100   Excellent
ctagtaacaaattgaacttactgttttatactcacatcattaagagccatttcagaagtg
tctgttactcgacttcaactatgttcttgttcttgtacattgtgtgcttaaaacttctag
tatgtacatgtggaaaatgggctcttcataataacagttcatctgtcgcattgtttctag
GACTATTCTTGATAAGAAAGAGCTCTTGGAGTTTGCTCAACTTGGCTGCTACTTGGAATA
TGATCTCTTTGGTACTGAACTACTTCATTACCAACTCGGCCCAGATATTGACATGCCTGA
TGATAACAAAAGAATTAGAAGGTAA
atatggtaaagcctctcatagcattccctttccctagccctttttgattgtcatatctag
ggaagtattagcaaagattcagaaaacagtaagcaggccgaaccacagacttgcagagaa
aaatatatctatgctgtttcagggagaaaaatctctctatattattttaaggagaaaatg

Exon 10 +      70156      70263   0    Initial    108    52    Marginal
acctagtttggtcttggtcacatggtgataagaagattgaatgaaccaagttagaatacc
taggaggagaaataaattggagattgacaaggaaggctttcgtttgggaatatctaagtg
ttgctacccagtgaagccctaagatatggtttgtatgtgatagttgaaccgtgggaatga
ATGACATCACTCAGAGAAGAAGATGAGGACAGAGACCTGGGGACAGAGACATTTAAGGAA
TGGAGTAGGAACCGTTTCTCAAGGAAAGGTCGAGGAGAAGTTTTCAAA
gtgataacatgagagatatatattcttatggaagtcagtagagaggaagtctcagggcag
aagggcttgaatgccggtaataagtgacaaatatcaagggaaataaagactgaaaagcat
ccattggatttcacaattaggaggctcacattttataaacagagtgcaatctcagtggaa

Exon 11 +      71295      71426   0    Initial    132    46    Marginal
ttgagtctagaaatcatgattgcatgcctgtgtattggcaccaatgcacacgatttggtg
attattttccaaagcaaaactgttttgcgttttggtagtggaaccagagaagttgtgtgc
gtacaagcagaaaatgggaacagttcaagagattgagggttgggattctatctgaaagag
ATGGATAACAATGGAGGAGTTGAGATGAGGGTCATGGGATCCAAGTTGGAGGGAAGAAAG
CATAGAGAGGAATGGTCAGATAGACAGGAAAAGCATAGCAGGGCAAATAAGTGGACTGCA
GGCTTTAATGAA
gtgggtggagcatatatatatatatatatatgttcaaatatatatactgtatgtgtatgt
gtatatatatatgtgtgtgtgtatatatatacacagtagaagaagtgagtggaaaaagta
gaaaaatgtaacatgatcggagtgggaaactgaagatggagatttcagagggggagcagt

Exon 12 +      74240      74451   0    Initial    212    60    Marginal
agtgcttgcattcctttgacctgcagatacaaagtctattcttccattataatttatttt
aaaatatgtgttctcagagggcagggctttgtgcttgagttttttttgtgtgtgtagtac
cccacgttttgctcactgtagtagttattaaatatgactcatgtactaggacaccaagaa
ATGCTTTTGAAACAAAAAAGATACCTTTCAAATAATCAGCCTCTGGAGGAAGGCACTGTC
CGTCCGTCTAGATCCACTTTAGAATCTAGACGCCAAAAAAACTATTCAGAGAATCCCATA
GAAGAGCCATTGTCTGTGAGTGGCATCTTCTACCATCAAAGACCCATGGAAGTCACGACA
GACACTGCCCAGAGTCCAGACACGTACAGATG
gtggctgtcaggaggtgactcacactacagattccagcatttaacaaagcaaagaggatt
tcatttttagagaatagtcaggaagctgttctttagtccactgactataaatttaaagga
acagcttattattttagcaatcttgctgacatggaaagaagacagaatatatttgtattg

Exon 13 +      74973      75054   0    Initial     82    64    Marginal
tacttgtagtgagattccttttgtttccctattttaatcgcaaacagtccttgatatttt
ttggccagataaaaggagagagcaagaatgagatctgaaaaatgggcccacagggagagg
catttgagagaggattgctgaatacaaatccagaacaaagttatttagtgaaatgccaaa
ATGGTCATTCATCCAAACTGGCACATCCTATTAGAAGCTATCTTTAATGCGGTATTGCCA
GGCATGGTCATAAATGTCACAG
gttagaaatttctgtatgcatggaataaggatatgttcctgctaggatgcagcaatattt
ttatcgtcaccacacaatatttattaaaggtctctcagtacacacgccacagtagaagtc
agtatctttacgacaagcacaataggttaatgagtaaaaagttgaaagcatcctgaaaag

Exon 14 +      75282      75492   2   Terminal    211    85        Good
tgcagcaatatttttatcgtcaccacacaatatttattaaaggtctctcagtacacacgc
cacagtagaagtcagtatctttacgacaagcacaataggttaatgagtaaaaagttgaaa
gcatcctgaaaagcgaaaatgaaagacaaatgacatctaatgagttaacatttttcacag
GGTGCGTCTCCTGGTGGAAGAGGGCTGTGAAGATCGAATTCTGGTAGCACATGACATACA
TACGAAAACCCGGCTGATGAAATATGGAGGTCACGGCTATTCTCATATACTCACCAATGT
TGTTCCTAAAATGTTGCTGAGAGGCATAACTGAGAATGTGCTTGATAAGATTCTAATAGA
GAACCCTAAGCAATGGCTAACTTTCAAATAG
gatggttgcttatgaattcacaccttgagtataaaacttgcagagaacattcagcgattt
ccagtccactgtgagatattaatcagttacctaggactaatgacagatcatttccttctg
atgagaactaggagggtttgccttctctgagaccagctattacaactgtgcctctaggga

--------------------------------------------------------------------------------