--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (105336 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2013       2373   2   Terminal    361    63    Marginal
cttctactgcctccaacacggcggcggcggcggctggcacatccagggacccgggccggt
tttaaacctcccgtgcgccgccgccgcaccccccgtggcccgggctccggaggccgccgg
cggaggcagccgttcggaggattattcgtcttctccccattccgctgccgccgctgccag
GCCTCTGGCTGCTGAGGAGAAGCAGGCCCAGTCGCTGCAACCATCCAGCAGCCGCCGCAG
CAGCCATTACCCGGCTGCGGTCCAGAGCCAAGCGGCGGCAGAGCGAGGGGCATCAGCTAC
CGCCAAGTCCAGAGCCATTTCCATCCTGCAGAAGAAGCCCCGCCACCAGCAGCTTCTGCC
ATCTCTCTCCTCCTTTTTCTTCAGCCACAGGCTCCCAGACATGACAGCCATCATCAAAGA
GATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGATTCGACTTAGACTTGACCTG
TATCCATTTCTGCGGCTGCTCCTCTTTACCTTTCTGTCACTCTCTTAGAACGTGGGAGTA
G
acggatgcgaaaatgtccgtagtttgggtgactataacatttaaccctggtcaggttgct
aggtcatatattttgtgtttcctttctgtgtattcaacctagggtgtgtttggctagacg
gaactcttgcctggttgcaagtgtcaagccaccgattgctttcttaggctatctatatgg

Exon  2 +      22941      23009   0    Initial     69    76        Good
gcaacagaaagagtatgtattttgcctaaggttgcacaataagttaagctggggttccaa
ttctagcaagttggttctagagtgtatgttattaaccattatgccgtagtgcctgcaagt
agatctctagatgtcagaaatactcatcttcctctggttacctggttgttataaatcttt
ATGCTTAATACTTATGTCATTATATGTAAATTTCGTATTAAACACTCAACTTATTCAGAA
GAATATCAG
gtaagtgtaggttaaggctgttttctatcagaaatcattatatgtatatatattcctcag
ttcttatgttgtttagtttttctaaaatgtcaaattttataatatatggagaagtataaa
tgtatattagaaagattttgtttatttgtgtaatttgtggcataagaaatatttgcctca

Exon  3 +      23626      23675   2   Internal     50   100   Excellent
aaattataacttactagttactaacttgggcaaattacccagtctttttgactctcaatt
tctttgtctatgaaatgtaatactatttaggattgttaggattaaatgagaatatatttg
gcatactgtctggtacatgatacttaacaggtactagttgtctacatctttctaacttag
GATGGATGCCGATGTCTTGGGTAACATCTCAAACTTTATCAGTAAGGAAG
gtgagaatctgaagaaaatgaaaccttaaaaagattgaattcctggactccatttaaagg
agtaaatagctcacgaacaagacttgctgctctgcaaagtcttccatgttgatcctggtc
tttgactccttatctgtctgattaaattgaattcgctgccgtggcatccttaaagctgga

Exon  4 +      27824      27897   1   Terminal     74    65    Marginal
gtttccaattagctcaaaaatgtcctttatggctggtttggctaaaacagtatccaggcc
agcattgcacctatgaaattggctgttaggaatcttgtatctttaaaaatcaagggcagc
aacccatcctcccgcttcccccacctcccaccacccccccaccttttttttttcttaaag
ATACTGGCTTGTTGAAGAGAGAATGGGTCATGTCCTACAAACTGTCTGAATTTGTCCAGT
TTGCTGTCTCATAG
tgtcatttagcttgttttatcctatgtatttcctgcaaattaaaatttgtatctgaatcc
ttggtggatttgagttgaagatccttaaccatcatagatgatgctgtgtcctttatattg
catgtcagaagttacatgatctttacttgattcatgatgaggagatggccactgaaattg

Exon  5 +      31811      31872   0    Initial     62    69    Marginal
cataaatggttatacataaatacattgaccaccttttattactccagctatagtggggaa
aactttcttttcataactagctaatgttttaaaaagtattcttttagtttgattgctgca
tatttcagatatttctttccttaactaaagtactcagatatttatccaaacattattgct
ATGGGATTTCCTGCAGAAAGACTTGAAGGCGTATACAGGAACAATATTGATGATGTAGTA
AG
gtaagaatgctttgattttctatttcaaatattgatgtttatattcatgttgtgttttca
tttagaaaagatttctaagccacagaaaaagatactttgtgatgtaaactattattgtag
tgctctataatcattttttggcttaccgtacctaatggacttcagggggatacagttcat

Exon  6 +      40091      40242   1   Terminal    152    50    Marginal
actattggcccccactctcttctggcttgtagagtttcagcggagagatctgctgttagt
ctgatgggcttccctttgtgggtaacccgacctttctctctggctgccctttacattttt
tcctgcatttccaccttggtgaatctaacaattatgtgtcttggggttgctcttctctag
GAGTATCTTTGTGGTGGTCTCTGTATTCCCTGAATTTGAATGTTGGCGTGCCTTGCTATG
TTGGGGAAGTTCTCCTGGATAATATCCTGAAGAGTGTTTTCCAGCTTGGTTCCATTCTCC
CCGTCACTGTCAAGTACACCAATCAAACGTAG
atttggtcttttcacatagtcccatatttcttggaggctttgttcatttctttttactgt
tttttctctaaacttctcttcttgcttcatttcattcatttgatctgcaattactgatac
cctttcttccacttgatcgaatcggctgctgaagcttgtgcatgcgtcatgtagttctcg

Exon  7 +      40552      40640   2   Internal     89    68    Marginal
cacttgatcgaatcggctgctgaagcttgtgcatgcgtcatgtagttctcgagccatgat
tttcagctccatcaggtcatttatggtcttctgtacactgtttattctagttagccattt
gtctaatcttttttcaagatttttagcttccttgcgatgggtttgaacatcctcctttag
CTCGGAGAAGTTTGTTACTACTGACCTTCTGAAGCCTACTTCTGTCAACTCGTCAAAGTC
ATTCTTCATCCAGCTTTGTTCCATTGCTG
gtgaggagctgtgatcctttggaggagaagaggcactctgggttttagaattttcagctt
ttctgctctgttttctccccatctttgtggttttatctacctttggtctttgattatggt
gacctacagatggggttttggtgtggatgtcctttttgttaatgttgatgctattccttt

Exon  8 +      44267      44398   0     Single    132    51    Marginal
ctgtcaatgaacagattattcattgtcatttctcatctgtttttgagattgtaactttga
ttctgtataactcatagaattagtagttagacctatatatgttagttattacattatttg
tatatgtacagactgctttagacaatattgtagtgttatatgttaattttatcaattaaa
ATGTGCTATAGGATCATTGTAGAGATCTTGTCTCTAATTAACAGGATTCATAAAGAGAAA
ACAAAGGAGAGAAACATCCAGATTGAAAAGACCTACATAGTGCCAAGCACAATAAAAGAA
ACCCTATACTAG
gcaaattattatgaaatttgttttaggacaccagaaataaagataatatctaaaaacttt
ttagaatcgcctaggagggattaggaatatgaatagcatctaacttgttggcagtagaat
tgaaggtagaaggtggtaaaacatcaccttgaaagttctgcattcagcctagaattctgt

Exon  9 +      70776      71014   1   Internal    239    95   Excellent
caagagactattttctatttaacaattagaaagttaagcaatacattatttttctctgga
atccagtgtttcttttaaatacctgttaagtttgtatgcaacatttctaaagttacctac
ttgttaattaaaaattcaagagtttttttttcttattctgaggttatctttttaccacag
TTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTT
GTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTA
AAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAAT
TTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAG
gtaagttattttttgatgtttttcctttcctcttcctggatctgagaatttattggaaaa
cagattttgggtttctttttttccttcagttttattgaggtgtaattgacaagtaaaaat
tatatataaatacaatgtataatatgatgttttgatgtatgtgtatatacattgtgaaat

Exon 10 +      74493      74552   0   Terminal     60    48    Marginal
gtaggatgatttaatcaatgatttttaattggaacaaatagtttttgtaatggtctaggc
ttttccaacttaactgtgctctcacatgtggtctctttttctccctctttcctccttctt
atacactctcacccacacacatatgcatacataccctgtctgatgtatctgcttcttcag
AATAGTTGGCTGTGCTCTGCTGATGATGAGAACTTGCCATTTAAGAAGGACTTGGGATAG

tccatgtcatcatgttcagggataaaagtaaaacccaagggcatttaaactttattgtat
tttattttctgtttccagtccaaattaaatccaagagaaggctccataatcaaaaagtaa
ggacatattttaaatttgccaatgggaagatattctagtcattacagtctggtaatacta

Exon 11 +      83270      83365   0   Terminal     96    69    Marginal
ttggtttgacagaggggaaactctttttgagataggcctatatttagggacaagagaaga
gacaaccaataagggttgaaagaaaccttgagagagtaagtcctatgacagaagcaggga
agtttcagaatgattgcagaaagatcagccaggctcttcctgttctccatcgtggtgcag
GATCAAGGTGAAAAGGATAACCCCATGCAGGAATTTTGCATCTGCAGGCTCCGCTTCAAC
ATCTGTTTAGGAGAAAGTGGAGACAGACTGACCTGA
gtaactaaggtcttggaacagcttacaggtcagaaccaggtgttttccaaagctagatat
actgttagcgcctttggcaacagaagaaatgaaaagactgttgtctgctgcacagttcga
ggggccaaggcagacgaaatcctggagaatgatctaaaggtgcaggagtgtgagttaaga

Exon 12 +      83387      83687   0   Internal    301    94   Excellent
ggaagtttcagaatgattgcagaaagatcagccaggctcttcctgttctccatcgtggtg
caggatcaaggtgaaaaggataaccccatgcaggaattttgcatctgcaggctccgcttc
aacatctgtttaggagaaagtggagacagactgacctgagtaactaaggtcttggaacag
CTTACAGGTCAGAACCAGGTGTTTTCCAAAGCTAGATATACTGTTAGCGCCTTTGGCAAC
AGAAGAAATGAAAAGACTGTTGTCTGCTGCACAGTTCGAGGGGCCAAGGCAGACGAAATC
CTGGAGAATGATCTAAAGGTGCAGGAGTGTGAGTTAAGAAAAAATAACTTCTCAGATACT
GGAAACTTTGGTTTTGGGACCCAGGAACACATTGATCTGGGTATCAGATATGACCCAAGC
ATTGATGTCTACAGCCTGGACTTCTATGTGGTGCTGGAAAAGCCAGGTTTCATCATTGCA
G
gtaagaagtgcgggacaggcttcattggtgccaaatagaatcagcaaagaggaggccatg
cgctggttccagcagaagtatgatgggatcatccttcctggcaaataaattctcatttct
acccaaaagggtaataaaaagttttcagtgaaatgtttaaaaaaaaaataaaaaaaagat

Exon 13 +      89881      90022   0   Internal    142    72        Good
gtattgatattgctcttatttattattgagctggatttaagtattaatcatttaaggtca
aatttctaatgtatatatgttcttaaatggctacgacccagttaccatagcaatttagtg
aaataactataatggaacattttttttcaatttggcttctcttttttttctgtccaccag
GGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAAT
CATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCA
ATGTTCAGTGGCGGAACTTGCA
gtaagtgcttgaaattctcatccttccatgtattggaacagttttcttaaccatatctag
aagtttacataaaaatttagaaagaaatttaccacatttgaaatttatgcaggagactat
atttctgaagcatttgaacaaattaattagctttgttgttcaactcattgggctaaagaa

Exon 14 +      93220      93338   0    Initial    119    49    Marginal
aatatacattgtacccattaagtaatttctcatcttctactcaccgtttcaagtctccac
tatttatcattccattctttacattctgattttcatttactaggtgtattagtctgtttt
tgcattgctttaaagaaatacctgagactgagtattaaacaggtttaacctgttttcttt
ATGAATTCTTCTTTAATTGGCTCATGGTTCTGCACGCTGTACAGAAAGCATAGCAGCATC
TGCTTCTGGGGAGGCCTCAGGAAGCCTCCAATCATGGCTGAAGGCAAAAGGGGAGCATG
gtgagaatgggagcaagaaagagaaggagtggtggggagaaggtgccacccacttttaaa
tgccagctcacttaccaccaagaggatggcccaagccattcatgtgggatctgcccccat
gattcaagcttcttccaccaggccccacctctagcactggggattacaattcaacctgag

Exon 15 +      95616      95782   1   Internal    167    89        Good
cttacattgtttatatttttatttcatttatttcagttgatttgcttgagatcaagattg
cagatacagaatccatatttcgtgtatattgctgatattaatcattaaaatcgtttttga
cagtttgacagttaaaggcatttcctgtgaaataatactggtatgtatttaaccatgcag
ATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCA
CACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCTGTGTGTGGTG
ATATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGCTAAAAAAG
gtttgtactttactttcattgggagaaatatccaaaataaggacagattaaaagctatat
tttattttatgacatgtaaggaactataatttgttttctattagatctgcaggtgttttg
cttactctggcattggtgagacattataagggtaaataatcctgtttgaaggaaaaggcc

Exon 16 +      98657      98881   0   Internal    225   100   Excellent
agattgccttataatagtctttgtgtttacctttattcagaatatcaaatgatagtttat
tttgttgactttttgcaaatgtttaacataggtgacagattttcttttttaaaaaaataa
aacatcattaattaaatatgtcatttcatttctttttcttttctttttttttttttttag
GACAAAATGTTTCACTTTTGGGTAAATACATTCTTCATACCAGGACCAGAGGAAACCTCA
GAAAAAGTAGAAAATGGAAGTCTATGTGATCAAGAAATCGATAGCATTTGCAGTATAGAG
CGTGCAGATAATGACAAGGAATATCTAGTACTTACTTTAACAAAAAATGATCTTGACAAA
GCAAATAAAGACAAAGCCAACCGATACTTTTCTCCAAATTTTAAG
gtcagttaaattaaacattttgtgggggttgttgacttgtatgtatgtgatgtgtgttta
attctaggagtacagctgatgaagaacttgcttgacaagtttttaacttatgtattattt
cgaagcagtgtttacgtagcagtaacatgaaagtttctaataaaatacccaatgtacaca

Exon 17 +      98949      98976   2   Terminal     28    71        Good
gtatagagcgtgcagataatgacaaggaatatctagtacttactttaacaaaaaatgatc
ttgacaaagcaaataaagacaaagccaaccgatacttttctccaaattttaaggtcagtt
aaattaaacattttgtgggggttgttgacttgtatgtatgtgatgtgtgtttaattctag
GAGTACAGCTGATGAAGAACTTGCTTGA
caagtttttaacttatgtattatttcgaagcagtgtttacgtagcagtaacatgaaagtt
tctaataaaatacccaatgtacacagcgtcaaaaaagctgcatttttccttttcctaatt
cttcgttgtttgctgaaatctggggcaaaggtgcgggagggggctaaatgactgggatat

Exon 18 +     101552     101591   2   Terminal     40    69    Marginal
aggatgtaatctgaattttgtgtttaatattccctgtgttcatgctttcaaaatacagat
gagtgaggaaagtagggagaaggggtaataaaggaagctgagagatcagttaagaggtac
ttgaatagtttagtaaagatgagagaagatgtttgcttcttgttgcccctcactgcttag
AATAGTGGCAGTGAAGGGTAACAAGAAGCTGTCAGATTAA
cttaaagagtttactgatgcagtggatgttggttgtaagagaagaattgataatgactct
tggataataggggagggaggggctgtcaatataatataatgaagaagggatttgaagtca
tttctgatttaaatctcacatccactacctacttttaatagatatgtagcctttaacaag

Exon 19 +     103050     103235   0   Terminal    186    92   Excellent
tgaacatcttaagaagagggtcatttaaaaggcctcttaaagatcatgtttgttacagtg
cttaaaaattaatatgttcatctgcaaaatggaataaaaaatctgttaaaaatatatttc
actaaatagtttaagatgagtcatatttgtgggttttcattttaaattttctttctctag
GTGAAGCTGTACTTCACAAAAACAGTAGAGGAGCCGTCAAATCCAGAGGCTAGCAGTTCA
ACTTCTGTAACACCAGATGTTAGTGACAATGAACCTGATCATTATAGATATTCTGACACC
ACTGACTCTGATCCAGAGAATGAACCTTTTGATGAAGATCAGCATACACAAATTACAAAA
GTCTGA
atttttttttatcaagagggataaaacaccatgaaaataaacttgaataaactgaaaatg
gacctttttttttttaatggcaataggacattgtgtcagattaccagttataggaacaat
tctcttttcctgaccaatcttgttttaccctatacatccacagggttttgacacttgttg

--------------------------------------------------------------------------------