--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6981 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (2 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3359       4297   0     Single    939    86        Good
gtagacatagaagatctgatcacttaatactgttctcttttactacatatgatagcacct
gcctgatatctagtgcactggctataattcagtcagcacaaaaatagtacatatgtattt
ggcactggggaagagcatttccgatccaggtgataatccctcttctttttgcattccaga
ATGATCCAGGTTTTAGATCCACGTCCTTTGACAAGTTCGGTCATGCCCGTGGATGTGGCC
ATGAGGCTTTGCTTGGCACATTCACCACCTGTGAAGAGTTTCCTGGGCCCGTACGATGAA
TTTCAACGACGACATTTTGTGAATAAATTAAAGCCCCTGAAATCATGTCTCAATATAAAA
CACAAAGCCAAATCACAGAATGACTGGAAGTGCTCACACAACCAAGCCAAGAAGCGCGTT
GTGTTTGCTGACTCCAAGGGCCTCTCTCTCACTGCGATCCATGTCTTCTCCGACCTCCCA
GAAGAACCAGCGTGGGATCTGCAGTTTGATCTCTTGGACCTTAATGATATCTCCTCTGCC
TTAAAACACCACGAGGAGAAAAACTTGATTTTAGATTTCCCTCAGCCTTCAACCGATTAC
TTAAGTTTCCGGAGCCACTTTCAGAAGAACTTTGTCTGTCTGGAGAACTGCTCGTTGCAA
GAGCGAACAGTGACAGGGACTGTTAAAGTCAAAAATGTGAGTTTTGAGAAGAAAGTTCAG
ATCCGTATCACTTTCGATTCTTGGAAAAACTACACTGACGTAGACTGTGTCTATATGAAA
AATGTGTATGGTGGCACAGATAGTGATACCTTCTCATTTGCCATTGACTTACCCCCTGTC
ATTCCAACTGAGCAGAAAATTGAGTTCTGCATTTCTTACCATGCTAATGGGCAAGTCTTT
TGGGACAACAATGATGGTCAGAATTATAGAATTGTTCATGTTCAATGGAAGCCTGATGGG
GTGCAGACACAGATGGCACCCCAGGACTGTGCATTCCACCAGACGTCTCCTAAGACAGAG
TTAGAGTCAACAATCTTTGGCAGTCCGAGGCTGGCTAGTGGGCTCTTCCCAGAGTGGCAG
AGCTGGGGGAGAATGGAGAACTTGGCCTCTTATCGATGA
attaagcaacaatgtaactggtcttgacttgtcatattcccccatgcaatcctaggtctg
tattgctcaattttaggaagcctttgctactccatcagtaggtttagatttgagcttttg
agacctggctatggaaaagaaagacacttgagaatttagtgttggggtctgtacagatga

Exon  2 +       5857       5931   0   Internal     75    67    Marginal
atttgaagtttggctagcatccatacttttctactgtaaatatttcactctcctctagct
atccttgatgagcttctcactttaagaataaatgtgtttgatataaggcctgagtatatt
ttctttctcaaagccacagtcaaataagaaactcaactgacattctcatttttcatttag
GAACAACTGAGCAGAGTTAGTATGGACCAAGACATGGATCCATCTGAGGATATTCACAAG
GCCCCAGTCTCAATA
gtgagcacacttcctaccacctgaccattggggctggagagcagggtcaataacttgagc
tgttgctactacttcttcccctaccctgactgtcctcatctatggtttctgctcacacac
acacaatctgctgggtcagggttatgttggaggccatgtctcagctttaaaatggggaag

--------------------------------------------------------------------------------