--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (24701 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5696       5806   2   Internal    111    98   Excellent
aaccagtattttttgtagagacagggtttcatcatgttgcctgggctagtctcaaactcc
tgacctcaagtgatccacttgcctcggcccgctaaagtgctagtattagaggtgtgagcc
attgtgcctagcctgtaatttaaaaatgtaacttattttgggattctttttctcctttag
GTATACTCTGGATAATAACGTTCTAACCCTGGAACAGAGAAAATTTTATGAAGAAAATGG
GTTTCTAGTAATCAAAAATCTTGTACCTGATGCCGATATTCAACGCTTTCG
gtacagtaacactatttgttattttacaatagtatgtattgtgtgcatgtaatgagaata
caaggtggattcgctcctggctttacagatgttttttaatgatttggtttgttgggaagt
gtttagaagcatgggctctggtgccagactggctttttattttttatagagaaaggttct

Exon  2 +       6706       6874   2   Internal    169    87        Good
ggaatggattctagccagacagtttctcctccctttcattggaattattctacctcaagc
tggaggccaacttagtgcagagaaaccacccctcaagtctgcaaccctttccacagagga
gggcagggcaggtgcttggagccagcggtaacgacatcatttgcaaattaaattttctag
GAATGAGTTTGAAAAAATCTGCAGAAAGGAGGTGAAACCATTAGGATTAACAGTAATGAG
AGATGTGACCATTTCGAAATCCGAATATGCTCCAAGTGAGAAGATGATCACGAAGGTCCA
GGATTTCCAGGAAGATAAGGAGCTCTTCAGATACTGCACTCTCCCCGAG
gtcagagaccacccttgctttgcgtcggcttaattgccagtgtgtatgtctgcctgtaaa
acccgctgatttggccgggcgcagtggctcactcctgtaatccgagcactgtgggaggct
gaggcaggtggatcgcttgatcccaggaaccactgctcttagagctggatatggaaagga

Exon  3 +       8204       8252   1   Internal     49    64    Marginal
ctaactaagggtagggaaatcattggctaaataacagtacaagttatgtcagaagttgtg
aggatggctcttgaatggctggcatttagaaaatcccagcctagatgaatacaaaaaaat
accaggctttataaaaagcaagtgtgtgcctgactgctaggcttttaataacctttccag
GGTTTCATACTCAAATTGCCAATATTCCTTATACACAAGAGATCAAAAA
gtgaggaagcagtagaaggtggcttattttttggagtcttttttttgcagaatcaaaatt
tgaatatcatgggttgttttattttcttcttcttcttcttttttttttttttttttgaga
cagagtctcactcttgttgcccaggctggactgcagtggtatgatctcagctcactgcaa

Exon  4 +      12816      12942   2   Internal    127   100   Excellent
aagccatccatctgcctcagcctcccactttgggatatatttttatatcccaaagtgctg
gggttacaggcgtgagccactgcactcggcctcgagtatcctttagtagcaggttttctt
ttcaggcaagaagacgtcccgtcaccccctgcaccaggacctgcactatttccccttcag
GCCCAGCGATCTCATCGTTTGCGCCTGGACGGCGATGGAGCACATCAGCCGGAACAACGG
CTGTCTGGTTGTGCTCCCAGGCACACACAAGGGCTCCCTGAAGCCCCACGATTACCCCAA
GTGGGAG
gtaggtctgcccggcggctgagtcttgatccgaatctccttcgcagtttctgtttcacat
cagtacctctaaagagtttacaaatgagatggcatttcctttctgagcaaaacattgtcc
taagatttgcagtgaggatcagagaaagttcaaggatgtcagagaaaacattcatcacac

Exon  5 +      17463      17647   0   Internal    185   100   Excellent
agatatctgagaggcttttgtatactgaaaaaaatgtaagcatttaatttagacatttat
ttctcttgggagagagaaatgctttctttccctgatgtttgctttccctgatgaaccatt
gacaatgtttttaattatggtactccctcaaatgtagacttcacttgcctcttgttctag
GGGGGAGTTAACAAAATGTTCCACGGGATCCAGGACTACGAGGAAAACAAGGCCCGGGTG
CACCTGGTGATGGAGAAGGGCGACACTGTTTTCTTCCATCCTTTGCTCATCCACGGATCT
GGTCAGAATAAAACCCAGGGATTCCGGAAGGTAAGCATTCACATTGCTGCACCTGCTGCA
GAAGT
gtgggttagaaacaaaaattgtattcaattcattgaattcaaattaattgaataaaattt
taattaaattgcattaacattttaaagatttgtggcttttaaccaacctggactttagtc
cagtttatttaccaggaaatatatttgcttaccttgggctttctgtgctcttatcagtaa

Exon  6 +      20215      20353   2   Terminal    139   100   Excellent
tacaaagagattgacacaggatgcaatggacctgactttccacttagaaatcaaatactg
agtgaaataaatgactttctaaaagaaagactccctgcttggtcactggtattcatggga
tgtttttctccaatatcaatttgttcactttgcacaggcaatttcctgccatttcgccag
TGCCGATTGCCACTACATTGACGTGAAGGGCACCAGTCAAGAAAACATCGAGAAGGAAGT
TGTAGGAATAGCACATAAATTCTTTGGAGCTGAAAATAGCGTGAACTTGAAGGTATGTTT
GTATACAATAGCAAGGTAA
aaatctcaggtttttcttttcttcagatgcttcataattctcatacctagtttatttgac
agtatatagtgcttgggtttagattcattttagggacatcgctgagcccccaccaaaaat
gacaatggaatttccatttacacttgtgcccccgtgcaggaggcttgagaacttcctgct

--------------------------------------------------------------------------------