--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (88558 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      21278      21311   0    Initial     34    74        Good
ggtagattgcttgagtccaggggttcgagaccagcctgggcaacatgacaaaaccccatc
tctacaaaaaatacaaaaattagccaggtatggtggtgcgtgcctgtagtcccaggtact
tgggaggctgaggtgggagtatcgcttgagactcgaaggtcaaggctgcagtgagccacc
ATGATCGTGCCACTGCGCTCCAGCCTGAGCAACA
gtgagaacctatctcaaaaaaaaaaaaaaaaagtcactctcatcacagtctccactgttg
taatggtccactgtctgcaaggacaagttattgatcaggaggatttccaaccaagagcga
gaacccaaacaaattagcacaactcatcttctgcttctgtaacaaacaagttgtccagtt

Exon  2 +      31556      31615   0    Initial     60    45    Marginal
tagtaatccacgtctagcaattaatcccacagatatattttcacatgcaaaaaattaagt
ataaggttattaattattgcaatgtttgtaataataaaagactggaaatcatccaagtat
tcatcaaaaaagagctagttaaatatatattcatacaccggaacattatgcaagggtaaa
ATGAATGAGAAAACCCTCTGTACTGATGTGGAAAGATTTGCCAAGACAGATCTGAAAAAG

gtgtgtaatagtgtggaaaggaggattaagcaaataaatgcctattttaaaatttatgca
taaaaaactgacagagcatgtaaggaacgaatagaaatgaccatctacttttagaagtga
ggaggagggaggctagagagatgggggcggaggcagaagtggcagcatggcttctgcata

Exon  3 +      36464      36563   1   Internal    100    76        Good
gcagggtagctagaaggaaagcatagtcacaaagagaggcaaaggccagggctggagaat
cagttcatagcatcaggagggtctaaggagtgaaatgcaacgatgtcttagtccatgcag
gctgctatcacaaaataccataccctggtggcttataaaaaacaaagttatttcttgcag
GTCTGGAGGCTGAGAAGTCCAAGAGCAAGGAACTTACAGATTCAGTGTCTGGTGAGGGCT
GCCTTCTTGCTATAAGCTCACATGGAGGAAAAACGGCCAG
gtggctctgtggggcctcttcataagagcactaattccattcatcagggctcctccctca
tgatctaattacctgccaaaggcccaacccaatcctatcacattaggcattatgtttttc
acaagcgaatataaagggcaaagggaacaaaaaataattagaccatagcagcctgtacat

Exon  4 +      36945      37012   0    Initial     68    65    Marginal
gcaaaaggcaaggggaggacccgcaacaagttctgctacagaatgtgacacaaactgagg
cacccgggtcaggaccaaggctgaacatcatttggcagccagcttactgcctactgtggg
ataagcctgaaggttgaagtggaagtcacaggaaccaagacatgaagggtctaagtcaga
ATGCTGACAGTGGAAATTGCAAGAAAGTTCTTATGTGATAGAGATCATGAAGAAAGACTC
AACAGGAT
gtgcggatacataattagatcaatgatacataattagagaggaaggagagcagtaggtcc
tataagccctcgtcgtcattttaaaagcaagccatgttccaagggtaaatttggaaacta
gttatttgggctttggaaaagttttatcacaaagagcccttttccataaggagatgcttt

Exon  5 +      38383      38454   2   Internal     72    95   Excellent
ggaccctgacacctagtttactctattagtaactttcacattagtgtggtacaatgaatg
aaccaaatatacattgtcgttaactgaagtccgtactttctttagatttccttaattttc
acctaacatttttctgttcaaggatcctatcccatgttacatttagttttgtctccttag
GTTCCTCTTGGCAGTGACAATTTCTCAGCCTTTCCTTGGTTTTGATGACCTTGACAGTTT
TGAGGAGTACAG
gtcagacactttgtagaatgcccttcttggagtttgtgtggtgttttctggtgattagaa
taggcaaaaaacgaacatggttatggcaaataggaagatcaggcaggctcagggctccag
tcaccctagtgtgcgtcctggccgattggcaactcctagcaactgtctcagagcaagggg

Exon  6 +      50496      50613   0   Internal    118   100   Excellent
agaaatgaaaaaaactatattagaatggacaaaggtgagtctctttcaaaatatttttta
tataagttgttacatgtatcagtttcgcaattaaaagtttaagatggatttatattggct
ccagtgaagaatatgtgttttattaattaatactgtgcttggttttgtcttattttatag
GAGAACCAGCAGAAATCCACCAATGTAGTCTATCAGGCCCACCATGTGAGCAGGAATAAG
AGAGGGCAAGTGGTTGGAACAAGGGGTGGGTTCCGAGGATGTACCGTGTGGCTAACAG
gtatgtcatgttcatatatatatatatatatacaaattgcaaactgacatgtgacacaat
tttatggaaattagtgtaacgtattacatgcttgttttatcattagaaggaggctgggag
atgtagtagaaagcctgggtgttagtcctaaccctaccatcagtgagaaatagagtcaag

Exon  7 +      54375      54574   1   Internal    200    89        Good
tagttatttcaaaatttgagagaaatgtaagtacttgccttgtagtcaactacactgatt
tctttctttcttttttttttttttaagatttagttatatttaaaattactagattagttc
acaatttgtcatcttaaactatccaggccgatgtcagtctgttttatctgttctgaacag
GTCTCTCTGGTGCTGGAAAAACAACGATAAGTTTTGCCCTGGAGGAGTACCTTGTCTCCC
ATGCCATCCCTTGTTACTCCCTGGATGGGGACAATGTCCGTCATGGCCTTAACAGAAATC
TCGGATTCTCTCCTGGGGACAGAGAGGAAAATATCCGCCGGATTGCTGAGGTGGCTAAGC
TGTTTGCTGATGCTGGTCTG
gtctgcattaccagctttatttctccattcgcaaaggtaaaaaaaaaaaaaaaaaaaaaa
ggcactacacacgattcccacacacagtgcaagtgctctccaactgctaggggaaggaat
cggagagggagggcataagaatgtctcctttcaatttcccgactatttcttcccccaata

Exon  8 +      55344      55482   0   Internal    139    91   Excellent
aagtccttgagagagctgtgtttaccagagtaaaatttctggactttctctcaagcactc
tgcaaagcacaaaccccagtgttatctcaaggctattgaaaaccaaagtacacagtgttt
tgtgatttagaatttcaccgtgaaacctctttttacattcttaatcatattgcttttcag
GATCGTGAGAATGCCCGCAAAATACATGAATCAGCAGGGCTGCCATTCTTTGAAATATTT
GTAGATGCACCTCTAAATATTTGTGAAAGCAGAGACGTAAAAGGCCTCTATAAAAGGGCC
AGAGCTGGGGAGATTAAAG
gtaagagaattggctagtagcgtctaccagttacataggctgtcagtcctcagtccttat
tctgtcctcagaaatcttccttgagtttcaaactgttttccaaaattgcatataacatgc
acaactttttatcagatcatgatatattcagtatgcccagaggcttattaaaaggtaggg

Exon  9 +      56045      56163   1   Internal    119    87        Good
gaaaatacagctatatattttcttacttatggctagaagtcaaggatggctgtttgacct
tttctgttaaagtgtgaattttcagtttaatacattattccaacatgtgttttgccttat
tgattaaaaagattattctgtcaatacagatgcgatgattgtcacccatatgctttgcag
GATTTACAGGTATTGATTCTGATTATGAGAAACCTGAAACTCCTGAGCGTGTGCTTAAAA
CCAATTTGTCCACAGTGAGTGACTGTGTCCACCAGGTAGTGGAACTTCTGCAAGAGCAG
gtaggtgaaccggttgtctttttttatatgtttaataaaatcatgaaagacaatctatgc
ctctttactgaagcattctttttacagttttcaagtttttaccaatgctgtttcatttca
gaacattgtaccctatactataatcaaagatatccacgaactctttgtgccggaaaacaa

Exon 10 +      56285      56398   0   Internal    114   100   Excellent
ccaatttgtccacagtgagtgactgtgtccaccaggtagtggaacttctgcaagagcagg
taggtgaaccggttgtctttttttatatgtttaataaaatcatgaaagacaatctatgcc
tctttactgaagcattctttttacagttttcaagtttttaccaatgctgtttcatttcag
AACATTGTACCCTATACTATAATCAAAGATATCCACGAACTCTTTGTGCCGGAAAACAAA
CTTGACCACGTCCGAGCTGAGGCTGAAACTCTCCCTTCATTATCAATTACTAAG
gtaagtgggtgcagactggtcaaataattaggcttaatatcagtcattataatttattta
caattactcttaacaataagaaaagtataaataaggtgcacataatgtccataaataaaa
cactcctttttttccaagttatttttaacctcttctccaaagaaatctctcaccaagaat

Exon 11 +      57032      57143   0   Internal    112    74        Good
tccaaacttaaatatttctggcccttagatcatgggttagcataacaggtggggacactt
aaaacatagaaggttctgccctcatcctcctgttaactgaataagaaaggacttccctgg
ggccagatgcctggaaaacagaacttatgaaaatgttcaactactttttgtgttttgcag
CTGGATCTCCAGTGGGTCCAGGTTTTGAGCGAAGGCTGGGCCACTCCCCTCAAAGGTTTC
ATGCGGGAGAAGGAGTACTTACAGGTTATGCACTTTGACACCCTGCTAGATG
gtatgtttttgttgttgtttcttactctttgttgttaaggaaaaaaaaaaatctttccca
gaagttttgcaggaacaggaagttagtctttagtttgcaaatcttattgcaaaactgttt
ggatcatttacagtgtgctccattctattatgtttaagcttccatttttaggattttttg

Exon 12 +      58557      58673   0     Single    117    61    Marginal
acataccagtctgctctcctgatgtcttttccaatagaatctacaaggcctgatggtcta
caaggaaggctgacttttatcttggtgtcttgattttgacacatgctgaacaccgactgc
ctgaagtaaaggtcattggacttagcagctagccatgagcaagaggttgattttgagcat
ATGAACAGAGCTGTGGCCAAAAGACAAGTGAACTACATTGAAAGAGGGGGCCTCATTACA
GACAACAAGGTGCTGTTGACCTTGGACAAGTGTTCCTCTCATAAAGAAAAATACTAG
ggtggtggaagtggttgcagaggtcagtgttaatggaaatcagaggtccttagcctgaga
tctaggacttcagggtgggctaacaaaaaatcttagaggcaaaaatgtttgtgttttgat
aagggaaggaaggagcattttcctgggttgagaatttatagcttttgatagattctgttt

Exon 13 +      68584      68789   1   Internal    206   100   Excellent
tcaaggacttgtcattatagaatctagagaaactggtgcagctaacacaactacttggat
ttgggtcttaatgcttcttgaaggaaatgtttggaaggggcattgtgcacatttgattca
tgcttcaaggatggcacaccttatatctagttttcgtgcatcacatggctctttccacag
ATGGCGTGATCAACATGAGCATCCCCATTGTACTGCCCGTCTCTGCAGAGGATAAGACAC
GGCTGGAAGGGTGCAGCAAGTTTGTCCTGGCACATGGTGGACGGAGGGTAGCTATCTTAC
GAGACGCTGAATTCTATGAACACAGAAAAGAGGAACGCTGTTCCCGTGTTTGGGGGACAA
CATGTACAAAACACCCCCATATCAAA
gtaagtcacaaaacctttggaaggactttcttgagctatttaaactgagaagaaaaataa
ctctttttaattcctttgcaaaggacttagaaaaactgggattaggtggaagaatgtatt
tctaaggtagtgtttgcaggctttgcctcaggagatgtttttagaaaggtgcaaagaaat

Exon 14 +      72946      73077   0    Initial    132    67    Marginal
ttcaactttcaggtcttattgtttaagaaatacattttgtaagggtatagctgctctaga
tggtgattcctcagatgaatgtgggcaaagtaaactgaaaaccttctggaagggattcac
cattctggatgccatcaagaacatttgcaattcgtgggaagaggttaaatatcaacacta
ATGGGAGTTTGGAAGAAGTTGATTTCATCCTTCATGGATGACTTTGAGGGGTTCAAGACT
TCAGTAGAGGAAGTAACTGCAGACGTGGTGGAAATAGCAAGAGAACTAGAATTAGAAGTG
GAGCCTGAAGAA
gtaactgaattgttgcaatctcatgatagaatttgaaaggatgaggagttgcttcctatg
aatgagcaaataaatcgtttttttgagatagaatctactcctggtgaagattctcttgaa
atggcaacaaagtattcagaatattatgtaagcttagttgataaagcagtggcagcctgt

Exon 15 +      82535      82670   0   Internal    136   100   Excellent
tttttaagagcataacgggttctagagaccaaaaagtttgagaaatactgtgccagaaat
actaaagaactgaaggcagttctttaactgtaacccgagattggtctaaaaggagaaaac
ttttcagataaaatagaaatcacaattaatcattagcaatcataacaatgttctttctag
ATGGTGATGGAAAGTGGGGACTGGCTGGTTGGTGGAGACCTTCAGGTGCTGGAGAAAATA
AGATGGAATGATGGGCTGGACCAATACCGTCTGACACCTCTGGAGCTCAAACAGAAATGT
AAAGAAATGAATGCTG
gtatgtaaactgttcttagtgcattttatttatttatttattgagatggtgtcttgttct
gtcacccaggctggagtgcaatggcacgatctcagctcactgcaacctctgcctcccagg
ttcaagtaattctcctgcctcagcctcctgagtagcttggattacaggtgcccaccacta

Exon 16 +      84673      84910   1   Internal    238    91   Excellent
ctgagatcgctgactgcactccagcctgggcaacagagtgagactctttcaaaaaaaaaa
aaaaaagccagtggataatgaatgcacagaacaataaacatagctgtgtcctttctgttc
ttgtggagaaatgacaccatgtgtttctgtgaccttccttcttctgctttcctctcccag
ATGCGGTGTTTGCATTCCAGTTGCGCAATCCTGTCCACAATGGCCATGCCCTGTTGATGC
AGGACACTCGCCGCAGGCTCCTAGAGAGGGGCTACAAGCACCCGGTCCTCCTACTACACC
CTCTGGGCGGCTGGACCAAGGATGACGATGTGCCTCTAGACTGGCGGATGAAGCAGCACG
CGGCTGTGCTCGAGGAAGGGGTCCTGGATCCCAAGTCAACCATTGTTGCCATCTTTCC
gtctcccatgttatatgctggccccacagaggtgagcaattcccagagctgggctttgag
actcaggaattcagactcagactttacatagaagagtaaatgagtctctgggatcctttc
tgtttcctcatgagcagattctggaatgttctggtgtctcttctttatctagcttaatta

Exon 17 +      86319      86531   2   Internal    213    93   Excellent
atgaagagtgcacggagtcttagaacctcagtgattttcttgcaattcttagttgactca
cattgctgaattacttttaaagtagaataaaggtgtctccataaaccatgacctacagat
ttgacccacaatgaccagcatgtcccttatggacattttctaggtccagtggcactgcag
GTCCCGGATGATTGCGGGTGCCAATTTCTACATTGTGGGGAGGGACCCTGCAGGAATGCC
CCATCCTGAAACCAAGAAGGATCTGTATGAACCCACTCATGGGGGCAAGGTCTTGAGCAT
GGCCCCTGGCCTCACCTCTGTGGAAATCATTCCATTCCGAGTGGCTGCCTACAACAAAGC
CAAAAAAGCCATGGACTTCTATGATCCAGCAAG
gtaggttttcagaggaaaattcttttatcaacatctgtataaaagaaatgatgaggcaga
atttgggccctttgaaaaactctccagtgcattgccacatgctcccaagtggactgagtc
ccttgagagtcaagacgtggtcttataaattttatgtcccctaaaattgtactacagtct

Exon 18 +      87132      87270   2   Terminal    139    76        Good
tagctgccattatttcccttctcttctgcaagttcctgaagatttagaggactgcccact
tttgaagatgcagcattttacagaaagaacatgggtctcaaaaaccataacctactccag
gaatccttaaggcagatatcatttacctacactgagttctttgttgccaccctgtaacag
GCACAATGAGTTTGACTTCATCTCAGGAACTCGAATGAGGAAGCTCGCCCGGGAAGGAGA
GAATCCCCCAGATGGCTTCATGGCCCCCAAAGCATGGAAGGTCCTGACAGATTATTACAG
GTCCCTGGAGAAGAACTAA
gcctttggctccagagtttctttctgaagtgctctttgattaccttttctatttttatga
ttagatgctttgtattaaattgcttctcaatgatgcattttaatcttttataatgaagta
aaagttgtgtctataattaaaaaaaaatatatatatatacacacacacatatacatacaa

Exon 19 +      88075      88216   2   Terminal    142    69    Marginal
gtcacaaaagttatattgtctaataagagaagtcttaatggcctctgtgaataatgtaac
tccagttacacggtgacttttaatagcatacagtgatttgatgaaaggacgtcaaacaat
gtggcgatgtcgtggaaagttatctttcccgctctttgctgtggtcattgtgtcttgcag
AAAGGATGGCCCTGATGCAGCAGCAGCGCCAGCTGTAATAAAAAATAATTCACACTATCA
GACTAGCAAGGCACTAGAACTGGAAAAGACCACAGAAAACAAAGAATCCAACCCTTTCAT
CTTACAGGTGAACAAACTGTGA
tgatgcacatgtatgtgttttgtaagctgtgagcaccgtaacaaaatgtaaatttgccat
tattaggaagtgctggtggcagtgaagaagcacccaggccacttgactcccagtctggtg
ccctgtctacaccagacaacacaggagctgggtcagattcccctcagctgcttaacaaag

--------------------------------------------------------------------------------