--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (39514 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (16 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1281       1334   2   Internal     54   100   Excellent
cgggaaattccccggcgcgggcagggagcggctggctgtcagctgagccgcgctgggcgg
ggtcgccaggccgcgcatcagccctaggcaccccagtcccggctgccccctccgccaccg
ccgccgcccgccggcaggttccctggtcagcgtcccatcccggtcgggagttctctccag
GCGGCACGATGCCGAGGAAACAGTGACCCTGAGCGAAGCCAAGCCGGGCGGCAG
gtgagccagggcagggggctgcagcggtgggcgagggggcggcggctccttcccggcggg
cgcttccgcggcctgaaaacggtacccgccgccctgccccgcggcccggagcctgtcggg
gtgagggtggcgaggggtggggcggccctcccgcgagacggctgccctgggaggatcccc

Exon  2 +       3121       3316   0    Initial    196    43    Marginal
ttatgctatattttcatttcatttcaaccaacatttactgcaagcctgctatgtgccagt
ctctagtaagaataacatggagagaaaatagacgggcagacgatagcagtaatttcagaa
tgggcggaggaggtggaaatgcagagtgttcttgggtgctcggagtagggaacagttcat
ATGACACAGGACATCATATTTAAGCTGGACATTGATCTGTCCAGTGGAAGTTTGCCAGGA
CACAAGGGGAGCCAGACATTTCGGGCAGAGGGCAGAAGGGAGGCAAGGACGCAGAGACAG
AAGAATGCAGGGAACCGTGAGCTCTTTAACGTGCCTTGGGTACGAGTGTTTTGGTGGCAG
GAGGTGACTCTGGTGG
gtcagttgggcctgggccctgaaaggccacgtttgtcttgttaagaaactgaaagtctgt
cgtgtatgggaagggtggactcaggggaatgacctcatattgcaaaagaaaccatgaggg
caagaggactgaaattgacagggctgaaagccagtcatttaggaggctgttaaaatgtat

Exon  3 +      10175      10320   2   Internal    146    98   Excellent
aagaatcaaaaatgtccaaaatgtaactggagagaaagtgggcaacttttggagtaagta
ttagcaatcgccaatgggtttgtgggactcccggggaccccttgtggggcgggggacagc
tctattttcaacaggtgacttttccacaggaacttctgcaatgtcccatcaacctctcag
CTGCCTCACTGAAAAGGAGGACAGCCCCAGTGAAAGCACAGGAAATGGACCCCCCCACCT
GGCCCACCCAAACCTGGACACGTTTACCCCGGAGGAGCTGCTGCAGCAGATGAAAGAGCT
CCTGACCGAGAACCACCAGCTGAAAG
gtgagcagggctggcccctgtgtgccccattcatcctgggcctgcaagaaatgccatccc
tttgcactaaggcttggtggtgagctcccttctccccgtttccataggtggtagctggtg
gggaagcacaggatttagcatttggcaaggctaaatctgttctgatttttacttttggaa

Exon  4 +      11306      11508   1   Internal    203    90   Excellent
gctagtcttttctgtaagcaaaaaccacttcgtctttttgctgctgacccttgggccaag
gctaagcatggcatctttcaattcagagccatgtggtcaagtggactagagggagatttg
gttcatcagatcaagtccactttcctggtgtgtgactccatcactctgaacctcctgcag
AAGCCATGAAGCTAAATAATCAAGCCATGAAAGGGAGATTTGAGGAGCTTTCGGCCTGGA
CAGAGAAACAGAAGGAAGAACGCCAGTTTTTTGAGATACAGAGCAAAGAAGCAAAAGAGC
GTCTAATGGCCTTGAGTCATGAGAATGAGAAATTGAAGGAAGAGCTTGGAAAACTAAAAG
GGAAATCAGAAAGGTCATCTGAG
gtgagcagaccgatccattgtgatgttgttttttttttttcccttgacatttgcagtgga
atcttacgtgtctagactcctagatcaaaacctttcatggttcagtctggattggtgttt
tgcctggtcttggaagaagtgcttttgctgaaaagattggttgccctattaagggtcatg

Exon  5 +      12055      12169   0    Initial    115    52    Marginal
ctcagaatttttacttgttgaccttgtctgttctctcagtctaaaatggagattattcac
tttacattttcctttttaaaaatgctttggaaaatgtcatgttgtggtaggaggctatcg
cattgccacagatgaaaagagaaagagacacatttttcttaacccaaagaacctggaaaa
ATGTGCTCATACCTGGGAGTGGATGTCAAAGATGATAGTAATGACACAACCCAGAACAAG
TTTGAAATCCCCACTGGGCGTGGTTTGTTAAGGAGTCCTCTGCTGTCCATGCCAA
gtgtggggagaatgggtgtgggtgggctttgatgggaggaaaagggcaggaggttgggtg
gtgggaacgttttttccttcctttctggaattttagacacagcttatgagtccactgttg
ccaaagtgtggttgattatttctatgatatcagattattccagcatggcaaggaaggctt

Exon  6 +      13485      13667   0   Internal    183   100   Excellent
aattattaaattttttgtaaagatgggggtcttgctatgttgcccaggctggtctcaaaa
tcctggcctcaagggatcctcccacttcagcctcccagagctctgcgattaagggcatga
gcccatggtgcccagccttagtttgatctgttcattcactttactccttgtcatctccag
GACCCCACTGATGACTCCAGGCTTCCCAGGGCCGAAGCGGAGCAGGAAAAGGACCAGCTC
AGGACCCAGGTGGTGAGGCTACAAGCAGAGAAGGCAGACCTGTTGGGCATCGTGTCTGAA
CTGCAGCTCAAGCTGAACTCCAGCGGCTCCTCAGAAGATTCCTTTGTTGAAATTAGGATG
GCT
gtgagtttttggttttatttttgttttgagcaaactataaagcctcccctggaaagatga
aacaaataccactttttcttgtcaacacaagccaaggattgaggaaattccagtgtagca
aagataaattggctctcattttctaagtatagcataatgcatgtaagggttatcatagct

Exon  7 +      17299      17429   0   Internal    131    80        Good
ggggagggtacgtttccatttcctctgagccaccccgtttaaacagtgcacatctgaatg
tttggaagcttccttgggttgcatgtcacaaaaattcatcttttgtctttttcttctttt
gacaaagaatttgtcttgtagacatattgtgttaaatcccttgcatttctgttttcacag
GAAGGAGAAGCAGAAGGGTCAGTAAAAGAAATCAAGCATAGTCCTGGGCCCACGAGAACA
GTCTCCACTGGCACGTATGTGAAGGAAGACTCGGGCTGTCAGGCAGACAGGCTGGGCAGG
CTCGTCACTGG
gtgcttgtcaccggaggtcaaatgttgtgacctgaggaagtaacttctttatgatttata
ccaggatctttccagaatatttggtttgaatgctatttaatgttgcagctcaaactggca
aagattaaaaactgtttggttcctgtttggctcacactgactgctctgttctagtggtgt

Exon  8 +      19920      20072   2   Internal    153    91   Excellent
catggaggagcttggcactgggggtcccaggaccagctgtgcttgttcactagttgagaa
ttagttggagaatgttctggaaagcagttcctttaagctggtcccagttatattgggtta
ctctcttcttagtctttggaatttttctgatgaaaaccttttaacctttatactgaacag
GGCATTGTCTAAATATAGGAGCAGATCTGCAGATGGGGCCAAGAATTACTTCGAACATGA
GGAGTTAACTGTGAGCCAGCTCCTGCTGTGCCTAAGGGAAGGGAATCAGAAGGTGGAGAG
ACTTGAAGTTGCACTCAAGGAGGCCAAAGAAAG
gtatgaaataggttaacttgaaatatgtgtttttttaaaacagctttcctgagatataat
taagataccatacagttcacccatttaaagtatacatttcagtgttttttagaatattcc
aggattgtgcaaccactgttactacaatataattttagaacattttttcccccaaacagc

Exon  9 +      23417      23519   2   Internal    103    97   Excellent
tagccaattttaggatgaaaaataaaactaatgctaatatagtgaatgtgtagagatttt
gaaaacccctgatcctttatcccaattgtaaacaatgttctttttagtacttctgtaata
attgctatttctcttaaagccaaagagaaagtaacttttctatcttctgtgattttccag
AGTTTCAGATTTTGAAAAGAAAACAAGTAATCGTTCTGAGATTGAAACCCAGACAGAGGG
GAGCACAGAGAAAGAGAATGATGAAGAGAAAGGCCCGGAGACT
gtgagtcctaagattccacggccactaccacacccacacacacgagagtagtccagccac
tgaattcaaatcttgtgatgggttatttgctttagaaatatagaaatcatgttgatattg
aatattatctatctattccttttatatgtccttgtcctgctctgtgtcaattgtagcgag

Exon 10 +      25027      25142   0   Internal    116    85        Good
aagtaccaagtatccaaaacattcttttcctacacaatgtttggggtattgtcaaagttg
gattgattcaccagccagtcttaattggctactaatggttcagcctgttttctcctaaag
aggtttgtttaatgtcagatgataattgtacagatatgtttgggatttcccgtatgatag
GTTGGAAGCGAAGTGGAAGCACTGAACCTCCAGGTGACATCTCTGTTTAAGGAGCTTCAA
GAGGCTCATACAAAACTCAGCAAAGCTGAGCTAATGAAGAAGAGACTTCAAGAAAA
gtaagaatgagagagcaattttatcctcctttgaaatatacatttttacaaagtatacta
ctatataaaaacatagttttttaactatgttatgactaaaagaaaaatagacacctaatt
aaaatataaattcagaatatactaatgttccagttaatgtgtgagcatgaaatacttgta

Exon 11 +      26450      26599   2   Internal    150   100   Excellent
agggttcagaaatatggccaggtctagtgaagaagcaaggaggattatgtatttcatttt
gcattcataaaccctacagccctaaaattcttatattgtacataaccttggggtttgttt
aaaagccactgcgacgtaaaggagcattgtttatcctcatgaaatcttgacctttcttag
GTGTCAGGCCCTTGAAAGGAAAAATTCTGCAATTCCATCAGAGTTGAATGAAAAGCAAGA
GCTTGTTTATACTAACAAAAAGTTAGAGCTACAAGTGGAAAGCATGCTATCAGAAATCAA
AATGGAACAGGCTAAAACAGAGGATGAAAA
gtgagtatgttgagtcagaagggcagcgacggggcagaggagggagaatcgcctttttat
acagattggaattcggatttgagaataaattttaaaaaatttctttttcacttatctgaa
ggagtcctagcagacctctcagagagggggataaaatttaaaagttttgtcataataaaa

Exon 12 +      26978      27104   2   Internal    127    91   Excellent
ctctgtcttgatttttcagaaaagattttttttgagagtaagaaatgctagtaggtcgtg
gggtgataaaggtaggcgagaagatttttctactggagtgttcagaaggttgggaggcaa
gactataagtttctatgatattttccccaggattccattttttaatatcttttttaatag
GTCCAAATTAACTGTGCTACAGATGACACACAACAAGCTTCTTCAAGAACATAATAATGC
ATTGAAAACAATTGAGGAACTAACAAGAAAAGAGGTATTCACTGAAAAAAATTACTTCCA
TAGCCTA
gtaatgaacagaaactgttgaacgttttgtatataaaatagttacatgaatccttcacta
aatctggtttcaaaggttgttttccaatgtatcattatttcttgcatctagggtttgtaa
cttctgatgttccacatatgtgtaatgtgctttattgcgtacaaagatgatgtgaatgtc

Exon 13 +      28777      28935   0   Internal    159   100   Excellent
caggcttgtctcccactcctgggctcaaacgatcctcccacctcagcctctcaattctag
gcatgagccaccacacccggccagagctgataattaaaaaaataaacctttttctaatat
tttactaaaacaggcagaattatttcaaaaccatttctagaataaatgtttctttttcag
TCAGAAAAAGTGGACAGGGCAGTGCTGAAGGAACTGAGTGAAAAACTGGAACTGGCAGAG
AAGGCTCTGGCTTCCAAACAGCTGCAAATGGATGAAATGAAGCAAACCATTGCCAAGCAG
GAAGAGGACCTGGAAACCATGACCATCCTCAGGGCTCAG
gtgaggcaccttccaaaaccccagctgagcgaggccagccctgactgtattctcgcattg
gaaagcaatggtgtttagaatgtttgtaattttctattttatatattttttcacccgtga
gtgtattaaaactttaaaattgaaacatttggaaagtgctcagtggatcttatctgttct

Exon 14 +      33099      33229   0   Internal    131   100   Excellent
tatctgctatcggaatgtacctggaaagtcatggtcattatactgttttctagcaggatt
gtgcatctgtgattcacaagggctattgaaggatacagcactacctcctcatcgcataaa
cactgtaagaatctgcattcatctaggtactaacttctgtatctttttttcctctaacag
ATGGAAGTTTACTGTTCTGATTTTCATGCTGAAAGAGCAGCGAGAGAGAAAATTCATGAG
GAAAAGGAGCAACTGGCATTGCAGCTGGCAGTTCTGCTGAAAGAGAATGATGCTTTCGAA
GACGGAGGCAG
gtaaggaaaagagagaggaggacccagagctcacatcagcatggccgtagaagaggtgcc
tgtccaaagacgttcctgatttgaactataagaatagctgtgttcgcgccactgcactcc
tgcctaggtgacagagcgagtcccctgtctgaaaaataaataataataataataattgct

Exon 15 +      34534      34613   2   Internal     80   100   Excellent
tttactttcactagtctcctagtgccaatagtatttaaaactaaaattagtctggttttt
atgaaccttggcagtgtagtttgagtcttttttcccctacttctgtggactgtctgctca
gtgttgtcatgtttcggggttgtagaacatcacacagcgtgttgcttttcgtcctggcag
GCAGTCCTTGATGGAGATGCAGAGTCGTCATGGGGCGAGAACAAGTGACTCTGACCAGCA
GGCTTACCTTGTTCAAAGAG
gtgagtcccgtgtgatcctggattttcaggaaatagctatcctatgaaaaagatgcttga
agaaaaattccacttcattctctacaatggattccaaatcaaggcaccaaaaatatagca
cccgtcagtctcattaccacagcactcccatctccatccattacccaccgaatccagacc

Exon 16 +      37777      37898   1   Terminal    122    54    Marginal
agatttttctctatgtgcatcgtgatgacttcagttaaagaccaaacacctgtgctcatg
tcccactacgtgttgaatacgaagttgaactgatgttaaaactcgccatctgttcttcaa
gtgaaacaaacacaactgcctgcaaaatggaactaatggaattatcatacttattcccag
GAGCTGAGGACAGGGACTGGCGGCAACAGCGGAATATTCCGATTCATTCCTGCCCCAAGT
GTGGAGAGGTTCTGCCTGACATAGACACGTTACAGATTCACGTGATGGATTGCATCATTT
AA
gtgttgatgtatcacctccccaaaactgttggtaaatgtcagattttttcctccaagagt
tgtgcttttgtgttatttgttttcactcaaatattttgcctcattattcttgttttaaaa
gaaagaaaacaggccgggcacagtggctcatgcctgtaatcccagcactttgggaggtcg

--------------------------------------------------------------------------------