--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (15442 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4843       4964   1   Terminal    122    79        Good
catctctctccgcatcatgtatttcatagcctgcttcatttcatgtcgtgacatgtggtg
atcaattgctcatgtgacttcaccttctaccttgctggctcaccaggtgtttttctgagt
cactgttctccactggctctgttcttgggcattttgtttctttccatttttccactgcag
TGAGCATCGTTGTGGAGGAGTCTGTCTCTGTCTCTGTCTCTGTGCCATTTTTAGGATCAC
ATCTTGGAGATGAAAAGGTGAAATCAAATGTTGTAAACGGTTTTAAGAATGTGGATATAT
AG
tagcaaattgttctccttaacgattgttcaaagtaagtcattcttgtgcatatcacctcc
catagatacctctatttccctctgggtattataaattaaatgattattctcaccatccca
ttatgcttctatttcatgctacatatttacatttcttttgttatcagtaagttgaacttt

Exon  2 +       7379       7484   0   Internal    106   100   Excellent
tcaactagatacttttccttgttctacaatttcagcctagattaactggtttgttcagtt
atgagctccacatcataacctctcagcagagcccagccgagatcctggtacacagcactc
agtcaaggattatcctttgaattaattcattctccaccctgacctttcttcacattacag
AATGTTCTCCTGGGCAGCGTTGTGATCTTTGCCACCTTCGTGACTTTATGCAATGCATCA
TGCTATTTCATACCTAATGAGGGAGTTCCAGGAGATTCAACCAGGA
gtaagtcttggcttttcaatgtttattatgttattgcagcctggtagatggacctgtctg
cagatgaaagcctttgtgtttctgtttgtttgtttctttgttttttgagatagtcatgct
ctgtctcccaggctggagtgcagtggcaccatttcagctcactgcaaactcctcctcccg

Exon  3 +       8683       8793   0     Single    111    58    Marginal
ctgtaagtctcaagccagtgctggccaagagggggacatagctgttctctgaggaacagc
tactccgtcttgcaaaattccaatcttcaggggtttagtttttgttttagttttttatag
actttatatagagtagttttagattcacagcaaaactgagcagaggtacagaaatttccc
ATGTGCCTCCTGCCCTCACACATGCACGACCTCCCCGTTATCAACATCGTCCACCACAGT
GGTGTATTTGTTATGACTGATGAACCTACCTTGCACATCATTATCACCTGA
gtccatagtttatgttagggcttcctcttggtgttgtggtattggggggttagttttcag
tcctatttctttctttttaaaaaattgtgggccagtcacaatggctcacgcctgtaatcc
cagcattttggggggccgaagcgggcggatcacgaggtcaggagatcgagaccctcctag

Exon  4 +      13895      14022   2   Internal    128   100   Excellent
cctgcaggatggaatgtaggggtgagctgtgtgactctatggtacagactggtccaggtt
cctggaggtcacactctggggctgccagccaaagggtgcccttaagttggagtgtgggtg
acttcctgaacagagctggcactggggagggggtgctcggggtcctttctcttctaacag
GCCCCAGTTTTGTCTCAATGACAGTGTTTCTACACCTGTGGGTTATGACAAAGACAACTG
CCAAAGAATCTTCAAGAAGGAGGACTGCAAGTATATCGTGGTGGAGAAGAAGGACCCAAA
AAAGACCT
gttctgtcagtgaatggataatctaatgtgcttctagtaggcacagggctcccaggccag
gcctcattctcctctggcctctaatagtcaatgattgtgtagccatgcctatcagtaaaa
agatttttgagcaaacacttgaatatgtgtgtccttttaatttataatttatgtatgcat

Exon  5 +      14643      14746   1   Internal    104    50    Marginal
acccgggaggcggaggttgcagtgagccaagatcacatcagtgcactccagcctgggtga
cagagtgagactccgtctcaaaaaacaagcaaacaaacaaacaaacccaaacccaaacaa
aacaaaacaaaacaaaatacatatgaataaaagttctatttttcctaaactctataatag
GTCATTGTGCATCCCTTACTCAGGGGACCACTGCCACTCTTACTGTTTCTGATGTCTGCA
CTCTGCTGCCCGTGTCCTGCTGTCTGGTGAACGATGAAAAAAAT
gtgtgtcttcaagctggaattagatcccttcttttctttacggtgttcctgtttatccct
ccttcctcttcatcaggaagtgtcttctatgatgtgtcccccacattcctctgtgtttgc
ttgaggtcaaagcagcttagaacaagaaacagcttagaacaagcctgtaaaacagcttag

--------------------------------------------------------------------------------