--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (12093 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1273       1403   0    Initial    131   100   Excellent
cccaggttaccacttttctctctcccacttcgccggcaacgtgagtctcccgcacatgct
actcgccttgacctcggaagcaaaactccgggagcggtcgtcccggaaccggaagcctcg
aggtttagtcccgcccccctctcctcgctgcttaggctccgcggcctccaagctgtagct
ATGACGGCGCGCGGGACTCCGAGCCGCTTCTTGGCCAGCGTTCTCCACAACGGACTGGGT
CGCTATGTGCAGCAGCTGCAGCGTCTGAGCTTCAGCGTCAGCCGCGACGGCGCCTCGTCT
CGCGGCGCCAG
gtgagccaagggaagtgcgcaggcgcgggtcggggtgggtgtggaggtggcaacgactcc
ccgggtaggtcgcccccagtcaggggtcatactgctcactgtcccgggtcgcttagggag
ttcgtggagcgggaggtgatcgacttcgcccgacggaatccaggggtcgtaatatatgta

Exon  2 +       1520       1626   2   Internal    107   100   Excellent
tgcagcagctgcagcgtctgagcttcagcgtcagccgcgacggcgcctcgtctcgcggcg
ccaggtgagccaagggaagtgcgcaggcgcgggtcggggtgggtgtggaggtggcaacga
ctccccgggtaggtcgcccccagtcaggggtcatactgctcactgtcccgggtcgcttag
GGAGTTCGTGGAGCGGGAGGTGATCGACTTCGCCCGACGGAATCCAGGGGTCGTAATATA
TGTAAACTCGCGTCCGTGCTGCGTGCCCAGAGTAGTGGCCGAATACC
gtgagtggggccgggctcgggctggagggcgggatcaggggctcgacccgctatcctcct
tctcgcttggtcgcaccggccagcttccacccactctcacccctcttctgccagttaacg
gggctgtgcgcgaggagagcatccactgcaagtcggtcgaggagatctcgacgctggtgc

Exon  3 +       1520       1943   2   Internal    424   100   Excellent
tgcagcagctgcagcgtctgagcttcagcgtcagccgcgacggcgcctcgtctcgcggcg
ccaggtgagccaagggaagtgcgcaggcgcgggtcggggtgggtgtggaggtggcaacga
ctccccgggtaggtcgcccccagtcaggggtcatactgctcactgtcccgggtcgcttag
GGAGTTCGTGGAGCGGGAGGTGATCGACTTCGCCCGACGGAATCCAGGGGTCGTAATATA
TGTAAACTCGCGTCCGTGCTGCGTGCCCAGAGTAGTGGCCGAATACCGTGAGTGGGGCCG
GGCTCGGGCTGGAGGGCGGGATCAGGGGCTCGACCCGCTATCCTCCTTCTCGCTTGGTCG
CACCGGCCAGCTTCCACCCACTCTCACCCCTCTTCTGCCAGTTAACGGGGCTGTGCGCGA
GGAGAGCATCCACTGCAAGTCGGTCGAGGAGATCTCGACGCTGGTGCAGAAGCTGGCCGA
CCAGTCGGGCTTGGACGTGATCCGCATCCGCAAGCCCTTCCACACCGACAACCCTAGCAT
CCAGGGCCAGTGGCACCCCTTCACCAACAAGCCGACCACGTTCCGCGGGCTACGCCCCCG
AGAG
gttcaggatcctgccccagcccaggtgcaagcacagtgaagagttgccccaccaactgca
gccccaggctttggactgttactccggtaaaggtggttcttcccctttgggattccaagc
ccaggcaaatggaacccatcaatgggcaagttgacagaggttctgcttgggataatgaag

Exon  4 +       4642       4787   0   Internal    146    80        Good
aaaagttgggagaagggtatggagtgggggtaatgaagggagggtggctgtgttagggag
gcagtggcccagcctgggacagataggctggcttggaagagcatttgttctgggaggctg
ggctcagacagagctctcatctagctgctccacgagctgcgtgtgcttccttttttccag
GATGCGGCTGAGTTCCTCGGCGAAGGAGCAGGGCCCTGCTGGTACTCCATTGTTGCTCTG
CCTCAGAAGCACATAGCTATTGCCATTCATCCTCCGCAGCCGGCTGGGCAGTGCCACCAA
GCCATTGGTCAGCTCAGCCGGTGGCG
gtgggggcggtgggggtggtggggctggggctccctccccagggatgatctggagacagc
tgccctccaggcccccagccccctcatcatcaccctcatcttcctctccaggacactggc
ctgagactgtctgcagttgcaccgcagatcctcctgcccggctggcccgacccagtgagt

Exon  5 +       5717       5754   1   Terminal     38    52    Marginal
acccaggctctgtgctcatgcttccacagaaggttcacgttggcccttcccaggaagcag
gcagtgccttgggcccttttccattctctctccatgctctcatcctctcctgtggtttca
atttctgccatctgccagtaactcctaatctctacctcagacttctctcctgagtgccag
ACTCGGATATCTACCATGTGCTGGGCATCTCCACATGA
ggtctcttggacacctcaaaaccaaagcttttctccccaacgacaccaagtcctttcctt
gaatcgccaccactgtgaatggcaccaccagccacacagttgcttaagtcagaaacctgg
gagtctcccttctctttcttgctcgcctttttgttttgttttgtttttttgagacggagt

Exon  6 +       9609       9898   1   Terminal    290    88        Good
ttgtccctgcactgaccactgtgtgctcagcgtgaaggctgcatagaagtgtgtacggct
tgaggtttcagcatccaggctgcagaccccacgcagtgtctcatacagtggaatgtggca
gatgagacgggctttcaggaaggaagtccacttcttctgcaggatcttcttccctcccag
GTCTCCCTGGGGAGGTAGAGGCACGGGATAAGGGGCCAGGGTCAGAGGTCCAGCCTCTAT
ACCCGTGCCCCAACGTCAGCCCAATCCACCTTGCAGACACGAGCCACACGGGCCACACGG
TGACTGCTGCGGCTCTGAGTGAAGCTGCCAGAGCCCTCCTCAGTGGCACGCTCCGTGAAG
AAGTAGTACACCTTGTCATCATCACCCACTGCACTGGCCTTGCTCTCCCGCACGAGGACG
GAGAACACAAACTCCGCATCTGTGGGTCAGGCAGTTTGAGAGGCTTTTGA
gacaggctggggattcctttccctcactctgaggctgacccctcacttgacaacacacag
gaatggaatggacaggctcacctggggatttgggggtggggtggtcagctggccaaggga
gtaaaaatgaagaaatagtcccctaccccccatcatcctgtgcctcatcctcctaaccat

--------------------------------------------------------------------------------