--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (31941 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       4409       4524   0   Internal    116   100   Excellent
catgaaggggtattgaatgtgacatccgtatccagcttcctgttgtgtcaaaacaacatt
gcaaaattgaaatccatgagcaggaggtgagtgggttttttgaagatctacttttaaagc
tttttagttcacttttaatctgttcattagttacatatttccccttcttttcacttgcag
GCAATATTACATAATTTCAGTTCCACAAATCCAACACAAGTAAATGGGTCTGTTATTGAT
GAGCCTGTACGGCTAAAACATGGAGATGTAATAACTATTATTGATCGTTCCTTCAG
gtaggtaaaagctgattggtctaacagtaaatgtcatcttctgattaaccataaactagt
gtcaaagtcaactgtcattcttctttaatgttcatggatgtcaaagtatttcaggttttc
attctcaacactaatcttaatttaaaaggatatggatctaggaagatgactaattgggac

Exon  2 +      15589      15760   0   Internal    172    91   Excellent
aactaaagtcataaaacatggtcctcaaaggtcaatgaacaaaaggcaaagaagacctgc
tactccaaaggtaggggcctcactgaatggctgctttacacataccggtgtcatcgaagc
ttgcattcagtgtggatttatgctttaatgtcctgtttacctccttcctgttttctacag
AAGCCTGTGGGCGAAGTTCACAGTCAATTTAGTACAGGCCACGCAAACTCTCCTTGTACC
ATAATAATAGGGAAAGCTCATACTGAAAAAGTACATGTGCCTGCTCGACCCTACAGAGTG
CTCAACAACTTCATTTCCAACCAAAAAATGGACTTTAAGGAAGATCTTTCAG
gtaaaaacgtagtcttagatcttataaatcttttgactctactgttttttactgtgttaa
tgtttgttttgctaactttgtttatctgctgtgaaagagattataaaataaacgactcaa
tcacccttctggggtcttagtgttcagggaagataaagctgttttggcttgcaaagacaa

Exon  3 +      17431      17556   2   Internal    126    51    Marginal
aaatgacctgtgtacacttttggcttctttattgtaagtaaccagggtgacatagcaaaa
aaatacaatggtgtctcaccatatttacatataaattactcatattcaaaattactgcca
attacaaaacagaaagataacagtttgtatactgtgcaattattcctgctaaccttttag
GTGGGAGCAGGCCCGGGGTAAGTGTGAGATGGGAGATGAGAATCTGTCTAATCTCTCATT
TGGCACTGGTCACTGTATTCCTGTCACAGAGGGAACAGCTTGCTACCCTGAAGATGTTTG
CGGTAG
gtaaatatttcctgtgtaatatggaccctaaccacataaggataatccatgttattttat
tggcgatttaaggcaagaaacagctgtttgtttctaatgtttgaaggaaaaaatgcctat
atttacgtcaatgacacagggcatggcaacctttggaggaaccttctgaagcagtatttt

Exon  4 +      23036      24907   0     Single   1872    91   Excellent
gctgaggctctagaggacctggttggcttcaaagaactcttccagacaccaggtcacact
gaggaatcaatgactgatgacaaaatcacagaagtatcctgtaaatctccacagccagag
tcattcaaaacctcaagaagctccaagcaaaggctcaagatacccctggtgaaagtggac
ATGAAAGAAGAGCCCCTAGCAGTCAGCAAGCTCACACGGACATCAGGGGAGACTACGCAA
ACACACACAGAGCCAACAGGAGATAGTAAGAGCATCAAAGCGTTTAAGGAGTCTCCAAAG
CAGATCCTGGACCCAGCAGCAAGTGTAACTGGTAGCAGGAGGCAGCTGAGAACTCGTAAG
GAAAAGGCCCGTGCTCTAGAAGACCTGGTTGACTTCAAAGAGCTCTTCTCAGCACCAGGT
CACACTGAAGAGTCAATGACTATTGACAAAAACACAAAAATTCCCTGCAAATCTCCCCCA
CCAGAACTAACAGACACTGCCACGAGCACAAAGAGATGCCCCAAGACACGTCCCAGGAAA
GAAGTAAAAGAGGAGCTCTCAGCAGTTGAGAGGCTCACGCAAACATCAGGGCAAAGCACA
CACACACACAAAGAACCAGCAAGCGGTGATGAGGGCATCAAAGTATTGAAGCAACGTGCA
AAGAAGAAACCAAACCCAGTAGAAGAGGAACCCAGCAGGAGAAGGCCAAGAGCACCTAAG
GAAAAGGCCCAACCCCTGGAAGACCTGGCCGGCTTCACAGAGCTCTCTGAAACATCAGGT
CACACTCAGGAATCACTGACTGCTGGCAAAGCCACTAAAATACCCTGCGAATCTCCCCCA
CTAGAAGTGGTAGACACCACAGCAAGCACAAAGAGGCATCTCAGGACACGTGTGCAGAAG
GTACAAGTAAAAGAAGAGCCTTCAGCAGTCAAGTTCACACAAACATCAGGGGAAACCACG
GATGCAGACAAAGAACCAGCAGGTGAAGATAAAGGCATCAAAGCATTGAAGGAATCTGCA
AAACAGACACCGGCTCCAGCAGCAAGTGTAACTGGCAGCAGGAGACGGCCAAGAGCACCC
AGGGAAAGTGCCCAAGCCATAGAAGACCTAGCTGGCTTCAAAGACCCAGCAGCAGGTCAC
ACTGAAGAATCAATGACTGATGACAAAACCACTAAAATACCCTGCAAATCATCACCAGAA
CTAGAAGACACCGCAACAAGCTCAAAGAGACGGCCCAGGACACGTGCCCAGAAAGTAGAA
GTGAAGGAGGAGCTGTTAGCAGTTGGCAAGCTCACACAAACCTCAGGGGAGACCACGCAC
ACCGACAAAGAGCCGGTAGGTGAGGGCAAAGGCACGAAAGCATTTAAGCAACCTGCAAAG
CGGAAGCTGGACGCAGAAGATGTAATTGGCAGCAGGAGACAGCCAAGAGCACCTAAGGAA
AAGGCCCAACCCCTGGAAGATCTGGCCAGCTTCCAAGAGCTCTCTCAAACACCAGGCCAC
ACTGAGGAACTGGCAAATGGTGCTGCTGATAGCTTTACAAGCGCTCCAAAGCAAACACCT
GACAGTGGAAAACCTCTAAAAATATCCAGAAGAGTTCTTCGGGCCCCTAAAGTAGAACCC
GTGGGAGACGTGGTAAGCACCAGAGACCCTGTAAAATCACAAAGCAAAAGCAACACTTCC
CTGCCCCCACTGCCCTTCAAGAGGGGAGGTGGCAAAGATGGAAGCGTCACGGGAACCAAG
AGGCTGCGCTGCATGCCAGCACCAGAGGAAATTGTGGAGGAGCTGCCAGCCAGCAAGAAG
CAGAGGGTTGCTCCCAGGGCAAGAGGCAAATCATCCGAACCCGTGGTCATCATGAAGAGA
AGTTTGAGGACTTCTGCAAAAAGAATTGAACCTGCGGAAGAGCTGAACAGCAACGACATG
AAAACCAACAAAGAGGAACACAAATTACAAGACTCGGTCCCTGAAAATAAGGTGAGAGGA
AGTATTACAGCATCACTCAATATCGTCTTGGATAGTTGTGAATTTCTGTGTTATACTTTG
CATGTAACCTGA
cgttataagtggttatcctttccccagagggtttcctttaacactgaataactgcaggcc
atggtaaagaatcttcttgggacctatagagggaatagactaatatgggaaaagaactag
tcaaacatgattaatgcaaacttagaagagtttctcaaaagccaaatgagtaatgttcat

Exon  5 +      25704      26195   0   Terminal    492    88        Good
agcaaagtaccaaggcattaccttgactatcctagatgacaagtctcttagacaattcat
cagtgtgtgattttcaaatgatttctccttttaggttactgttgattgtgctccctgttg
aattttgaagtttgttttactaattattggaattttgtggatgtcttctcatttctttag
GGAATATCCCTGCGCTCCAGACGCCAAAATAAGACTGAGGCAGAACAGCAAATAACTGAG
GTCTTTGTATTAGCAGAAAGAATAGAAATAAACAGAAATGAAAAGAAGCCCATGAAGACC
TCCCCAGAGATGGACATTCAGAATCCAGATGATGGAGCCCGGAAACCCATACCTAGAGAC
AAAGTCACTGAGAACAAAAGGTGCTTGAGGTCTGCTAGACAGAATGAGAGCTCCCAGCCT
AAGGTGGCAGAGGAGAGCGGAGGGCAGAAGAGTGCGAAGGTTCTCATGCAGAATCAGAAA
GGGAAAGGAGAAGCAGGAAATTCAGACTCCATGTGCCTGAGATCAAGAAAGACAAAAAGC
CAGCCTGCAGCAAGCACTTTGGAGAGCAAATCTGTGCAGAGAGTAACGCGGAGTGTCAAG
AGGTGTGCAGAAAATCCAAAGAAGGTAAGCCATTTACTGTTTCCCTGTTTTAAAAGACAC
AGAATGTTTTGA
tgtattttttgcccaaggttgcaaaggcaaacaaaaagcattatcttcaacagcactctg
ccagctcccagttacattaatggaaggagcattatgctaagacataaatttggtcatttt
agttatattttgttgtgtctactttgggaatttcacttcaaatagcaaattcacgttatg

--------------------------------------------------------------------------------