--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (24514 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3956       4102   0     Single    147    54    Marginal
ggacaggcatttttgttttcctgcccaaaagttgcatttcccaagaccaccctggcctgc
catgcccccatcctgtgcctataaaaaccccaaatcctaacaaggcagagacagaaccgg
gtggactttgagaggatcacatcggcagaggaatacacaggtggctagacatctagagaa
ATGCACCGAAAGGCACCAGTACGCCAGCGGGCCACCTACTGGCAGAAGCAGAATGACGCT
GAGTTTGGCTGGGGCAGTCAGAAGACAGTCCAGGCTGCTGAGCAGCCGGACTCTAGGGGA
AAACGTTCCTACTCCATCCCCTTCTGA
cttccccccaagctacctccactcaatgaaaccctgcactcattcaccaagcccaggtgt
gatccgatccttccggtaaaccaaagcaagaactcaggatacagaaagccctctgtcctt
gccataaggtagagggtctaattgagctggttaacacaagcctgtagatggcaaaactta

Exon  2 +       4547       4714   0   Internal    168    80        Good
cgggtcatagtcccacaacctgcccccatctgtatgctcccctagaggtctgagcagcgg
gggcctgaagaagcgagccacacccccactgcacaccctgtgaggacaagggaacttttc
ctgtttcactacctctcaagcacattgatcaccaaatactacctttcgttgctccttcag
GTTCCGAGGAACAGAGCTGTAGAGGTCACCAAATTAGCAATAGAAGCTGGCTTCCGCCAT
ATTGATTCTGCTTATTTATACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAG
ATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAG
gtactgtgcctatgatgagcatgtatgcacatgtgtttaatgggattgtgtggagatgac
aattctgtaactggttcagtagttgtgggtgaattgtgcttattagttccaatttattca
cacatattcaggtattaaagctaaaataaaaggcagagaatgatgatgcctttctcatca

Exon  3 +      10644      10895   0     Single    252   100   Excellent
acaaattcttcttgctgtcactatccttttgttatctgttgtaattttttctcttgagaa
tcactgctattttcattgtcatatcttaacagttgttgctttaacagttctgtcttgcat
ttatcataatctgcagccaactgcacaaataattcctcacaacccctttctccccaggtc
ATGGAGAAGTGTAAGGATGCAGGATTGGCCAAGTCCATCGGGGTGTCAAACTTCAACTGC
AGGCAGCTGGAGATGATCCTCAACAAGCCAGGACTCAAGTACAAGCCTGTCTGCAACCAG
GTGAGCACCCTCAGCCTCCTCTCCTTTCTCTTCTCAATGTCCATCTTCCTGTCCTACTGC
CTGGCTTCCATTTGTTTTGTTCCACTTACATTTGTGAAACAGAAGATTCTAGAAAGCAAA
ACATCTGTCTAG
aagaaaacggaagacccttaattgcacctcttcttggagaagtcttaatgaaaatggtac
agagaccttcatgctaaattgtgtgtactatttttgggggaggtgaatttcatcaaggag
gactgaaatggttaatcagaactcagggagaaggtggacttatctctaaggtatgaaaga

Exon  4 +      16955      17091   0    Initial    137    66    Marginal
gttcatagagttgctaatgctcagaaataacatttctatatatacttttagaccagtaat
ataaactgtatttttataaaatgattgttacttgacagtaatattctgttcaaatttaat
gttatactttattcagcttattttaatctttatattaacatatctgttttgaattatctg
ATGCTTTTCTCTCTTGATCATCTAAAGGTAGAATGTCATCCTTACCTCAACCAGAGCAAA
CTGCTGGATTTCTGCAAGTCAAAAGACATTGTTCTGGTTGCCCACAGTGCTCTGGGAACC
CAACGACATAAACTATG
gtaataagagcatcaggaagtttacctaaaatgccattttgatgaaaaattttagttata
gcatactcagtctcctagagttcattctcaatgggtcagggtaaggggataatttgcatt
tcttatgagataccaggtgatgctgctgctgttcagggacctcacttgagaggctctggt

Exon  5 +      17360      17525   2   Internal    166   100   Excellent
caatgggtcagggtaaggggataatttgcatttcttatgagataccaggtgatgctgctg
ctgttcagggacctcacttgagaggctctggtgcagaatgaacaccttagtctgtttagg
gagcctcctaccaaactgaatccagcctcaagacttcagcatttctggctttccttccag
GGTGGACCCAAACTCCCCAGTTCTTTTGGAGGACCCAGTTCTTTGTGCCTTAGCAAAGAA
ACACAAACAAACCCCAGCCCTGATTGCCCTGCGCTACCAGCTGCAGCGTGGGGTTGTGGT
CCTGGCCAAGAGCTACAATGAGCAGCGGATCAGAGAGAACATCCAG
gtgaggagttgggtgggcatcagggctcctgcacagtgtccttcacacgtgtgcttcttg
taaggttctcaggacacccttggactaagtccacttcctgggcatttcctatgcacaaat
gctttgtgtgcataagtgttttctactctaccacaggaggggcagcatgggtggagagaa

Exon  6 +      21077      21163   0   Terminal     87    97   Excellent
atttatattttatctgatattctttaatcacttgagagtttagagatggtctttcataac
ttttggaaacttatcaagtattttacatattgcctctacaccctactgtgtgatatactt
ggctattccaagttgacaattatgcaatctaagaataaacattttctacttctttggtag
GTTTTTGAATTCCAGTTGACATCAGAGGATATGAAAGTTCTAGATGGTCTAAACAGAAAT
TATCGATATGTTGTCATGGATTTGTAA
gtaactttggaaaatgggtttcccagtttatttttagaggaggaatgtcagatgggtgtt
gaaagtgacctcaataccagggagacagaggccagtgcaagtgagaggtgagacaggaac
tctctggaactctccttctggattcactccagagctctgttctctgacagggtgagtgga

--------------------------------------------------------------------------------