--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (16940 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3689       3856   0   Internal    168    98   Excellent
tgcccaacctttattactaactgggaaagacccagggagactgggatgggctcatgattc
tacatacagaactcatccaagaaaggaggaaaagctgatttttgtgaacgtcgctacttg
tgcctgaactaactctcaggcacattagtcagaaaatactacctatggttactcccccag
GTTCCTAAAAGTAAAGCTTTAGAGGCCACCAAATTGGCAATTGAAGCTGGCTTCCGCCAT
ATTGATTCTGCTCATTTATACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAG
ATTGCAGATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAG
gtactgtgcctatgatgagcttgtgtgcacatgtatttattgtgattgtgtggaggtggc
agttctatgactggatccatagtatagggtgaattgtgcttatttattacgatttattca
cacttactcatgtattaaaactaatatcaaaggcaggaagtgaagatggctttctcatct

Exon  2 +       6084       6161   0   Internal     78    72        Good
gcctgtcacctgaagacattccttataccttcatatgtagtacactctgtacataccact
ctctggagcactgcatcacctacctcatggaggattagtgtccttaaatgtacctcagag
catggctatgtgtggagaaattgacttgtgacatcactaaactgactgcttctacttcag
CCAGGTGAGGAAGTGATCCCAAAAGATGAAAATGGAAAAATACTATTTGACACAGTGGAT
CTCTGTGCCACATGGGAG
gtgagtgtttggaggtgagagaacggataagaaagatgaggtaggatacatctgtttcct
atcttcttagtacaagtatggaaaatgcaccattggatcaaaaacttaggaactttacaa
aggtagtttttgtgagcagtgaggaaaaagaaatgacaggcatacaaaagagagaagtgg

Exon  3 +       6239       6357   0    Initial    119    74        Good
actaaactgactgcttctacttcagccaggtgaggaagtgatcccaaaagatgaaaatgg
aaaaatactatttgacacagtggatctctgtgccacatgggaggtgagtgtttggaggtg
agagaacggataagaaagatgaggtaggatacatctgtttcctatcttcttagtacaagt
ATGGAAAATGCACCATTGGATCAAAAACTTAGGAACTTTACAAAGGTAGTTTTTGTGAGC
AGTGAGGAAAAAGAAATGACAGGCATACAAAAGAGAGAAGTGGAGGAGAAGAATTGGGG
gtaaggaggactgggatttatttccttgccttttcactaatctctccagtttcccaagga
ggaaacagaaatacttactcttgcaatcactatcttcttccccaattttctgttttattt
tttcccttttaagaaccacggctagctagttttattgtcatatctagacagttgttactt

Exon  4 +       6597       6719   0   Internal    123   100   Excellent
aggaaacagaaatacttactcttgcaatcactatcttcttccccaattttctgttttatt
ttttcccttttaagaaccacggctagctagttttattgtcatatctagacagttgttact
ttcacagttctgtgtcacatttatcttgatcttccacacctcacaattcctttttcccag
GCCGTGGAGAAGTGTAAAGATGCAGGATTGGCCAAGTCCATCGGGGTGTCCAACTTCAAC
CGCAGGCAGCTGGAGATGATCCTCAACAAGCCAGGGCTCAAGTACAAGCCTGTCTGCAAC
CAG
gtgagcaccctcagcctcctctcctttctgttcttcatgcccctctttctgtcctattgc
caagtatccattcatttagtcccacttatctttgtaaaagagaagattctagagagcaaa
gactctgtctcgaagggcatagagggatcttacttgtacccggcttagaaaagtcttaga

Exon  5 +       7257       7373   0     Single    117    55    Marginal
gaagccgtgaagagatggaatgaacagtacataaggagagagtgagagcaagagaagaga
aatactagggattcacatgggcttcggatgtctcagtgcctcttggtgtctctgctttca
cacttcttgaccaagggcatagatacactaaaaattatctgcagacaatgaaggtcatcc
ATGGTAGAAAGAGAAAATAACCTGTTTATGGGAGATATCTGTTCACAGTGGATGAAATCC
ACACTGAGGAAGGTTCAGCAGAACATGGAGCTGACCTATGACTGCCCCCGCTCCTAG
ttggctgctcttctttggagtctgtcatgcaatcagctgcttaaacacatctattctcta
tgtgttccttttgtagcctagagataattccatcttttccttgagtcctgactggtgatt
ccaggcctccttgatcaaattgactgtccccaaatgttacacacatttcagcattaaagt

Exon  6 +       9307       9466   0    Initial    160    63    Marginal
aattactgtaatgaccaccatcagagtagacaaagattgttgttctttttctcattgtcg
cactaattactacagactcacggattcttgtgttatgatttttaatttattttactcatt
ttttaatgctcacatctactcagcatatatatattatatatatatatatataaaatatat
ATGAAAGAAGAATGTGATCAAAGACTCATGAGGGCAAGTGTAAAAGACAAAAGCACTTGT
TTCATAGGGAACCCACTGGTGACATTTGAGATATCAACATACAAATCCATCATACAAAAA
GGAAAAGTAATGAAAGACTGTGAAAATTATCAGTATTTAT
gtgtgtatgtatattttctagttcatctatatagatatatatcatagatggcatatatga
tatatatattatatgtcagatcaattagaaaacatacatatacatgtatgcatttttggt
attaattaggaaactagttcttttgtctttcagacctgccctcatgagtctttgaccaaa

Exon  7 +       9976      10085   0   Internal    110    93   Excellent
ttctattttcttaggagagaggggcataaaatttatttttatgaaaaagatcatttttga
caataatattctcagttcaaatttaatgctctacattattcagcttcttttactttggtg
attttaatattagtgtaacttttggattatctgatgcttttccatcttgctcgtctgcag
GTGGAATGTCATCCTTACTTCAACCAGAGAAAACTGCTGGATTTCTGCAAGTCAAAAGAC
ATTGTTCTGGTTGCCTATAGTGCTCTGGGATCCCACCGAGAAGAACCATG
gtaataagagatacaggaagtttacctaaaacaccggtttgataaaaaaaatttaatcag
atcatgctgtttcctggagttcactcacagctgacttggggtgagggaagaatttgcatt
tctgacgagatcccaggtgatgttgaggctgctgttcgggggcctcgcttgagaagctcc

Exon  8 +      10359      10524   2   Internal    166   100   Excellent
acttggggtgagggaagaatttgcatttctgacgagatcccaggtgatgttgaggctgct
gttcgggggcctcgcttgagaagctccggtgcagagtggacgccttagtctgtttaggga
gccgcctaacaaactgtatccccagcctcagggcctcagcctttctgcctttccttccag
GGTGGACCCGAACTCCCCGGTGCTCTTGGAGGACCCAGTCCTTTGTGCCTTGGCAAAAAA
GCACAAGCGAACCCCAGCCCTGATTGCCCTGCGCTACCAGCTACAGCGTGGGGTTGTGGT
CCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAACGTGCAG
gtgaggagcggggctgtgggcctcaggtctcctgcacagtgtccttcacacgtgtgcttc
ttgtaaggctctcaggacagccttgggccagctccatttccctgtatttcctatgcatga
actctttgtgtacgtcataagggtttcttctactctagcacaggagaggcaacagaggtg

Exon  9 +      11302      11477   0    Initial    176    43    Marginal
attccttctgttcctggctgggctctcatgtgtgttcagggcagtgaggcagctctgctt
caggatgtccctggggcatctgtgtgagcgcccccctctcccatgcagttctttatcctc
cagccatccagcccagggttcacctcagcacagggcatgaccccaaggcagtgagtggac
ATGTGCAAAGCCTTTTCAGGTCTAGGCTCAGAGCTGCCAACCATTGCTTCTGGGAAATTC
TATCACCTAATGCAAGTTACAGGACAGGTCAGACTCAAGGGGTGGGGAAAAAGACACCAC
CTCTTGTTGGAAGGAGCTGGAAATTCATATAACCAAGCAAGTGGATACAGGGACAT
gtgattgttagagggcatgttcctaattaatctatcatttatacgatatgtgtgaaataa
catattaatagttatatgtatgaatatgaatatatataaattgatatactatttcatata
ttcttaagaatacatccaagtctctaaagaattaatatccagaatacatgcatatatatg

Exon 10 +      13626      13708   0   Internal     83    98   Excellent
gcttatttttgactggttttcattgaccacttgggtgtttagagaggtctttcataaatt
ttggaaacgtatcaatcttttaagtattgtctctgcaccctactgtctgatgaacttggt
tgttcccaattggcaatgatgtaatctaaaaataattaaagttttctattactttgatag
GTGTTTGAATTCCAGTTGACTTCAGAGGAGATGAAAGCCATAGATGGCCTAAACAGAAAT
GTGCGATATTTGACCCTTGATAT
gtaagtaattttggagatggttgtcctaatttattttcagaggaggaacgtaggatgggt
gttgagagtgacctccacaccaggggcacagaggccaacgtgagacagaggtgagacagg
agctttctggaagtctcctcctggattcactccagagctctgttctctggcagggagagt

Exon 11 +      13882      13986   2   Internal    105    62    Marginal
ttgatatgtaagtaattttggagatggttgtcctaatttattttcagaggaggaacgtag
gatgggtgttgagagtgacctccacaccaggggcacagaggccaacgtgagacagaggtg
agacaggagctttctggaagtctcctcctggattcactccagagctctgttctctggcag
GGAGAGTGGCCTGGGGTCAGCATGGGTCAACCTGTGCCTCTGCTCTCGTGACTCCAAGGA
ACTTTCCAGAGCAGCCAAGATCATTGCTGAATCTGCACCTTCCAT
gtaggcctgctgtttgtgctactgtctagtgtacacactgtggatattgcccatgtggtc
gcattagatgtttccaaatctgtgcttctatcttgttcttcccaacctgctcaatgtctt
accagatcaaaggcagttccgtcaatcttgtgggccaggttccaattcccacctctttca

--------------------------------------------------------------------------------