--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (20080 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (14 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        985       1224   0    Initial    240    45    Marginal
agtttattaggaaatggcctgaaattccagcatgatagcaagctggcatcctctgtggaa
tgtgcaaaccatgcctgcatctgcccattaccctagctcagtgtctctgggcatttctgc
agttgttctgaaggcttggcgtgtttatctcccacaggcggctgaaccgcctcccgtttc
ATGAGCAGACCAGTGGAATGCAGTGGAAGAGACCCAGGCCTCCGGCCACCCAGATTAGAG
AGTTTTGTGCTGAGGTCCCTATATGGTTGTGTTAGACTGAACGACAGGCTCAAGTCTGTC
TTTGCTCCTTGTTTGGGAAGCAAGTGGGAGGAGAGCAGGCCAAGGGGCTATATAACCCTT
CAGCTTTCAGCTTCCCTGAACACCACCCAGTGTGGAGCAGCCCAGCCAAGCACTGTCAGG

gtaagtggcgccaggccaaggatgtgacttatagattccagtggctcttttaattacccg
gtataataagacatcatctgcagggatttggctgggttcatgcactgatatttctgaatg
aagattgtactactaaaatgattgtagcttttggctttaatgatctaacgttaaagacag

Exon  2 +       5002       5139   1   Internal    138    97   Excellent
ctgaaagcttatagtgtaactaaagtacttccagatacatgctatattagataagggtca
gaggatagcactaggacacagaggagggcccccaaacccagccttggaggtgggagttgt
caggtaagtgccacaaatgcccaattacagctgaggctgcttcctccctgttttctatag
AATCCTGTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTG
ACAATGGCTCTGGGCTCTGTAAGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTT
TCCCATCCATTGTGGGAC
gtcccagacatcaggtgaggaaaattatgattggaacataacaggacacagattaggttc
ctctgtgttcatgtttatccccagattgtctatctctttctgcccagaagttatgtaacc
ttgttacaaatagacctctaatgattaaggtccaggagtaaatgccaatttcacatataa

Exon  3 +       5397       5512   1   Internal    116    95   Excellent
tccccagattgtctatctctttctgcccagaagttatgtaaccttgttacaaatagacct
ctaatgattaaggtccaggagtaaatgccaatttcacatataatgtagacagattatctg
atgggcatctatcagatacaaagtctgcccctttttcatgtcctttttgtctaaatatag
TCATTATCATCATCATCATCATCATCAAATCATTTCATCACCATCAGAAATGCTTATACA
TTATCCTGATGTATACCAAAGCTACTGTTTGGAAAGAAACTAAAATAAAAGTCCAG
gtcacttaaccatacagggctgatgttagatgaaagcaagcatcgataccaaatgcaatt
ttacataatattacctgtcaacaaaatatatttggacagccgcatggtaattttacacat
tatgtgtaaacaaagtattggtggcatcacatggtaaaaactcagtaatttcacctcaga

Exon  4 +       5535       5618   0    Initial     84    46    Marginal
caaagtctgcccctttttcatgtcctttttgtctaaatatagtcattatcatcatcatca
tcatcatcaaatcatttcatcaccatcagaaatgcttatacattatcctgatgtatacca
aagctactgtttggaaagaaactaaaataaaagtccaggtcacttaaccatacagggctg
ATGTTAGATGAAAGCAAGCATCGATACCAAATGCAATTTTACATAATATTACCTGTCAAC
AAAATATATTTGGACAGCCGCATG
gtaattttacacattatgtgtaaacaaagtattggtggcatcacatggtaaaaactcagt
aatttcacctcagaaattcttcttcacatcagaaatgtagtttgtgcattgaggctatct
gattgatgtttatgcctctctgcttgggatatattcatgagaataaataatagaaacctc

Exon  5 +       6569       6697   0   Internal    129   100   Excellent
ttccaatcaactgcagaattttgcttaagagcatagtggcaatgagactcaatatgttta
ttgttgctgataatcagaagaggaacttcccatctcaatgacttaaccttttgtggcttg
gctgtaattgattcacaagttttgggagatgctgactcataatgtgttgaacctttttag
GGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAA
AGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGACGAC
ATGGAAAAG
gtatgggaggtttgctgcagcttgggccctcaggatgcataatccctgtgttctctgata
cagaacaccacactactgctggggaaataactggctcacattgctcaactgtacttttac
ttgttaatgttcattctgggttattacccattgaaaaaaaaatccttgtagccataaaaa

Exon  6 +       6906       7054   0    Initial    149    46    Marginal
ctcaggatgcataatccctgtgttctctgatacagaacaccacactactgctggggaaat
aactggctcacattgctcaactgtacttttacttgttaatgttcattctgggttattacc
cattgaaaaaaaaatccttgtagccataaaaaatgatgagttcatgtcctttgtagggac
ATGGATGAAGCTGGAAACCATCATCCTCAGCAAACTGTCGCAAGGACAAAAAACCAAACA
CCGCATGTTCTCACTCATAGGTGGGAATTGAACAACGAGAACACATGGACACAGGAAGGG
GAACATCACACACCGGGGACTGTTGTGGG
gtggggggagggggaggaatagcattaggagatatacctaatgtaaatgacgagttaatg
ggtgcagcacaccaacatggcacatgtatacatatgtaacaaacctgcacgttgtgcaca
tgtaccctaaaacttaaagtataataataataaaatttaaaaaaaaaagaaaaaaaaatc

Exon  7 +      10048      10158   0   Internal    111    92   Excellent
gaaggtacttacacactttgagcttcagtctctgcatctataaaaccatggacacatgca
tgagtacttgtagcatttcctttggtcttggtttcaagtagcttctggtccctttttggg
aaatgcaggacctcatgacagcacatcattgtgtttctcctctgtcccccaactcactag
ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAGCATCCCACCCTG
CTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACTCAA
gtaagtatgctaccccagcacacaacactgtggggtctggggaaacttctgttagaagga
ggctatgcagcacagcagagagaaggccggagctaggagtccaccaacagactaacagcc
ttcagtgaactcagggatcccaaaggacaggaacagcttgaaagtacttgcatccttcct

Exon  8 +      12044      12170   0   Internal    127    89        Good
ttcccctccccaccctgtcaggccattgatgtgatggctccccattcacaccttcatttc
tcctctttaacgtgaccagggctgttctgaacctccttactttggcctcctctgcccaga
acaggtcaggcccctctgcatccatcaaccaggtgtgctctcctgaccattctttgtcag
ATGGGCACCTTCACTAACTCAGCTCTTTGGATTGCTTTGCAGATTATGTTTGAGACTTTC
AATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTGTCTCTCTATGCCTCTGGACGC
ACAACTG
gtaggtggctgggcgggacagcaagctggttggagcgcactgccagagatgggattgaat
ggtcgttaacacgtgggggtgacggactggagttgagttagaatggacacggctgaaccc
agccctaaaagatcttcttctagtgttcaaaataagcccttgatctcatatttctagcag

Exon  9 +      12565      12716   1   Internal    152   100   Excellent
tactttttttcatcttccccgagccctgtcccacctcacctctcctatcacatgccctgt
tttctctttttaaataagaggctcggaaattccctctcccccaaggcttccctctacttg
tccagcaagtaaccacatgccagctgccatggtgacttatcacgcccaattgtctcccag
GCATCGTGCTGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATCTATGAGGGCTATG
CCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCA
TGAAGATCCTGACTGAGCGTGGCTATTCCTTC
gttactactggtgaggcctgtgggagataagggggagaggggagcagtgtgttgctcagt
aacttccaggaccatcctcactatccaaggagatgatgggatgaagttttgcaaatggca
aggcctggctctaatgcacagagcaaagcacatctttctttgctgtgtgaagttgcaaaa

Exon 10 +      12995      13042   0   Terminal     48    69    Marginal
ggatgaagttttgcaaatggcaaggcctggctctaatgcacagagcaaagcacatctttc
tttgctgtgtgaagttgcaaaatgattacactatttccttgaggagaacagttatagaca
cccagtgttatgcattagtcagtgttgtataattgatctttttttaatcccctccattag
CAAATAGAAGAAGATTGTGCAGAGACTGAAGATGGCATGGTGTGGTGA
ttggcaggagacattgtgataggactcgagtcccaactctgctactcagtagctctgtga
gcttggacaagttaaccaaccatagtctctttatttgtaaaatggggataataatagacc
ctatatcacatgattgttatcagtattaaatggaagaacgcatgtggaatacttgacata

Exon 11 +      14257      14530   1   Internal    274    61    Marginal
aggtggttccctggtggccctactacgtcattatcattgtggattttggattgcagaata
ttgaactgacacattttttgatggcacatgtcttgagggagagactgcagtagggcaggt
gaatctttgccacctgtgcagaccctaatgtttgccacaatgtttgtatctggttgacag
CTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTG
AAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTG
ATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGC
CATCCTTCATCGGTAGGCAACAAACGCCCTTTTCCTGGGAAGGGGAGTCATTGTCTTCTT
CCATATCAAGCCAGCCTCCAGAACATGGAGACAA
gtgacggttgccccaagaccaaaagcatttctaaaccagaaaaagggaaagtgccacatt
ttcaaggcgagaagacataatgaggccaggaaaaaggttttcttcctaagaaaacactat
ctatgttgcagttaagcccaaagcattcatggtgtatgatgaaagaattaaataatgcct

Exon 12 +      15609      15899   2   Internal    291   100   Excellent
atttaaaccacatggagtgagtagtgagtctattaaaaaatcagtgatacctgttgtagc
ccacacctcaggatgctgcagcaggccttcctcattagaaggcaggcaggaagacataga
gcataacaagacccttttgtctctcagacaggtggttcctagattattatgtcttcccag
CCTCAGTCCACTGCAAGATCATCCAGATGTTCAAGTCTGGTCTTCCATGTCTAGCCTGGG
TTTTACTCTCCACTTAAGGACCATGGCCTGTGTCTCTTTTCCAGGGATGGAGTCTGCTGG
CATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCT
CTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAAT
GCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCAAGGTACT
gttcagtgacagacccagtggcaatgccgccagcagtgtcagccctataaccacagataa
gaactcttcagagactgtattttggtgacatgcaattgtgggttttaggggtaggtaatg
gacacaaatctcatattttacaggatgtaagtcaatctagttcataagaaaaattgagtt

Exon 13 +      18226      18358   2   Internal    133    50    Marginal
cttaagaggcacctattgcaagggaatgtccccagcaggggaccctgagttccccaatgt
taaacagagcatctgggtgaaaagtggtagttcacttcaccacgtggaaacacatttgta
tactaagtcctagcacaattaaaacttctcctttgaataggctagggtttgtttctacag
AAAGTGTATCGTGTTGAATTCTGAGGCAGAGTTCATGGAAATCAGAGGCATTGCCAGGGT
TCTTAAGTGGGGGCCATGGCTGGATTTGGAGCCAACTTTCAGTTTGCTCAATAATGTGGT
CGAAGAGTTACAG
gtgagaaaaacgaatgtgcttactgaagaatttctaaatccatggctccctctggcggtc
ctgccaagaacatgacacaattaggacacaattggcatctaacagacaagcctgtgtccc
tgctgaacaagaaactaggccatggtagaacatccaggctctgtcctaccgcactaacga

Exon 14 +      18589      18732   0   Terminal    144    92   Excellent
tctggcggtcctgccaagaacatgacacaattaggacacaattggcatctaacagacaag
cctgtgtccctgctgaacaagaaactaggccatggtagaacatccaggctctgtcctacc
gcactaacgactgcactaatgatgacattaatgaccattctttttcatcttgactgacag
ATCATTGCCCCTCCGGAGCGCAAATACTCTGTCTGGATCGGTGGCTCCATCCTGGCCTCT
CTGTCCACCTTCCAGCAGATGTGGATCAGCAAACAGGAATACGATGAAGCCGGGCCTTCC
ATTGTCCACCGCAAATGCTTCTAA
aacactttcctgctcctctctgtctctagcacacaactgtgaatgtcctgtggaattatg
ccttcagttcttttccaaatcattcctagccaaagctctgactcgttacctatgtgtttt
ttaataaatctgaaataggctactggtaacttcttgcgttggcctccgatcaatactcga

--------------------------------------------------------------------------------