Gene XCL1 Variant 1
DNA : 5.46 KbNT_004668
mRNA : 1222 bp NM_002995
CDS : 345 bp NP_002986
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  81 bp
tgaacagggaaagggactttttttttttttttttttaagaaaaataaaagcatcagtatt
gcaaagactttccatgatcctacacccacctcgaaagccccctctcaccacaggaagtgc
actgaccactggaggcataaaagaggtcctcaaagagcccgatcctcactctccttgcac
AGCTCAGCAGGACCTCAGCCATGAGACTTCTCATCCTGGCCCTCCTTGGCATCTGCTCTC
TCACTGCATACATTGTGGAAG
gtaagtggagaagctgtctgtgagataaagaacagggaggcaaggcaggtgggcacacat
tttgggtttgactcaggttatgactggactaacctgctttccccaggggagccttaaact
tcccatgtgcaagaaaggaatgatgattttgactgtagagggcttcgtaaacttccaaaa
EXON 2  115 bp
atttactaagaatctgtgacgggcaagagattcgggatgcctatcagtcctctcttcccc
caaaaagcaaatggccttaaattctcacaacattctcagagtaatttaacagatgattgt
tcctgtgatctggataattgctttatttttaattgtctgttgtttttttttcctcaccag
GTGTAGGGAGTGAAGTCTCAGATAAGAGGACCTGTGTGAGCCTCACTACCCAGCGACTGC
CGGTTAGCAGAATCAAGACCTACACCATCACGGAAGGCTCCTTGAGAGCAGTAAT
gtgagtctgcctcctcagaagttgtgctgggtgggtatctagaagtatagaaatacactc
tgtagaaatgctgccgtcctcaggaaaagtaggtcagcatagaggaacacctcaacttaa
ccaaaaacctctttagttttccttatcaatcatgtctttctgcagcccaaccgaatagcg
EXON 3  1026 bp
tcctttatgttaaaatagatggcagaagaagggtactcatttatgatctcatggctctga
aagactatttcttgcagtaatttctgcacaagatctcttcatgtctgccctgatcttaac
tcctgaccctgaggctttgagaatgtggctaacttcgtctgtcttttccttgcgttacag
TTTTATTACCAAACGTGGCCTAAAAGTCTGTGCTGATCCACAAGCCACATGGGTGAGAGA
CGTGGTCAGGAGCATGGACAGGAAATCCAACACCAGAAATAACATGATCCAGACCAAGCC
AACAGGAACCCAGCAATCGACCAATACAGCTGTGACTCTGACTGGCTAGTAGTCTCTGGC
ACCCTGTCCGTCTCCAGCCAGCCAGCTCATTTCACTTTACACGCTCATGGACTGAGTTTA
TACTCACCTTTTATGAAAGCACTGCATGAATAAAATTATTCCTTTGTATTTTTACTTTTA
AATGTCTTCTGTATTCACTTATATGTTCTAATTAATAAATTATTTATTATTAAGAATAGT
TCCCTAGTCTATTCATTATATTTAGGGAAAGGTAGTGTATCATTGTTGTTTGATTTCTGA
CCTTGTACCTCTCTTTGATGGTAACCATAATGGAAGAGATTCTGGCTAGTGTCTATCAGA
GGTGAAAGCTATATCAATCTCTCTTAGAGTCCAGCTTGTAATGGTTCTTTACACATCAGT
CACAAGTTACAGCTGTGACAATGGCAACAATTTGAGATGTATTTCAACTTGTCTCTATAA
TAGAATTCTGTTTATAGAATAAGGGAGAAAATAATCCAGTCTTCACTGGGTTCCCATTCT
GAGGGTCCACTACTCAAAAATTTGCTTCACTCAATTTTTTTCACCTCTTTGTGTTTTATT
TTGGTGTCCTATTAAAGGAATAAAATGACACAACTTGTCCCTTTTTTGTCCCATTAGCAA
AAATTAGAATTTTGGTATAAAGAAACTTTATTCAAGTAAAAATCAATACCCTTTGAATTG
GACAATAATCTCACTACCTTATTAGGATTTCTGTATTTGCCATTACGCTAGTTATCATGC
ATGTTATGCTTTACTGCGAATAAGCTTTTAATGCTCCAAATGCTGACCCATGCAATATTT
CCTCATGTGATCACAATTTGCAGTAAACTTTTAATTAAATGCTCATCTGGTAACTCAACA
CCCCAG
attcatgctgtcttgtatgctaattaaattgctgatttgtttcatgcttagggttttact
atccaagtagctgacgatgtatacattctcttctatcagactctgaataggaagacctga
ccttgccttgatagttttaagtgaaaaatattggctgttgtttattcttgtgggggcatt