Gene WNT2B Variant 2
DNA : 12.04 KbNT_019273
mRNA : 1969 bp NM_024494
CDS : 1176 bp NP_078613
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  201 bp
gtcggcttccggacatcgcaacttgcgcccctctcggggatcctcctcccgggctctgga
ccccaggtgatcctaggtccccagccgccggcgaacaccatggccccccaggggggtgag
gtaggagcagcctgagtacccccagaaggtgccccgtccacgcccctccgggctgcgcgg
CGGGAGTCTTCGGGGAGCTATGCTGAGACCGGGTGGTGCGGAGGAAGCTGCGCAGCTCCC
GCTTCGGCGCGCCAGCGCCCCGGTCCCTGTGCCGTCGCCCGCGGCCCCCGACGGCTCCCG
GGCTTCGGCCCGCCTAGGTCTTGCCTGCCTTCTGCTCCTGCTGCTGCTGACGCTGCCGGC
CCGCGTAGACACGTCCTGGTG
gtaagtgtggctctcaggctgggcgggtgaggcgcttggtaggagaggccggaggcgcct
ggagggactggctgctcacgggaccaggctgttgcttcgacgggttggagacgattcggg
caggactgtcactgaaatctgaagtcgcggggtggcgggagggtgaggcgccgcgtctta
EXON 2  221 bp
ctattaatacttcttcagaactgtgggaaatggttctactcatcagctttatggaatgtg
ggttagggagaggggacagaatctcttcaaggtctggatgctaaacgtaccccttcctta
ttccctcccaatgcagaaaaaggtctgggatgttctgacagggccatctctgccttgcag
GTACATTGGGGCACTGGGGGCACGAGTGATCTGTGACAATATCCCTGGTTTGGTGAGCCG
GCAGCGGCAGCTGTGCCAGCGTTACCCAGACATCATGCGTTCAGTGGGCGAGGGTGCCCG
AGAATGGATCCGAGAGTGTCAGCACCAATTCCGCCACCACCGCTGGAACTGTACCACCCT
GGACCGGGACCACACCGTCTTTGGCCGTGTCATGCTCAGAA
gtaagagcctcttccatcctgtgtcagctccttccctttctgtgctgggggtggtgagtg
ggaagagtaggcaagatctcccctctcctctcccacacactgtttcatcatcagagaaag
aactgtgggcagagcccaggatataattgggaacagactcttagcatcttagatttgtag
EXON 3  278 bp
ggtcagatactctggggaatgctcttggaaatgaaaggcaccttgaataaagggggtgta
ggggtgactctgggaaagaaaattagggaagaggtttcagagtcagaggttgtatgggct
gaagaaggggacagacatgggcctctttcctgaagcacacctctacaattctctctctag
GTAGCCGAGAGGCAGCTTTTGTATATGCCATCTCATCAGCAGGGGTAGTCCACGCTATTA
CTCGCGCCTGTAGCCAGGGTGAACTGAGTGTGTGCAGCTGTGACCCCTACACCCGTGGCC
GACACCATGACCAGCGTGGGGACTTTGACTGGGGTGGCTGCAGTGACAACATCCACTACG
GTGTCCGTTTTGCCAAGGCCTTCGTGGATGCCAAGGAGAAGAGGCTTAAGGATGCCCGGG
CCCTCATGAACTTACATAATAACCGCTGTGGTCGCACG
gtcagtactcatgtctgtgtaagtacactcatatttgctgggggtgaccagtgtgtgtga
ccatggactaaataaatgtgaagatggaagagctgaaggcttctgggtcacttccaaaag
ccccaacatcctgggacaggagaactaaatgcaagggagcttaggaatgcctagggtcaa
EXON 4  265 bp
tttcttgaacttgatcaggaagaatgggtgggatctgatgtgggagagaaccgagagctc
aatcggccagccagggccaggtccagcctatctcagagcactcatccttttggacctagg
gatgactaaaatgtgtcctgaccagctacttctcccttaactgccttccccctcccccag
GCTGTGCGGCGGTTTCTGAAGCTGGAGTGTAAGTGCCATGGCGTGAGTGGTTCCTGTACT
CTGCGCACCTGCTGGCGTGCACTCTCAGATTTCCGCCGCACAGGTGATTACCTGCGGCGA
CGCTATGATGGGGCTGTGCAGGTGATGGCCACCCAAGATGGTGCCAACTTCACCGCAGCC
CGCCAAGGCTATCGCCGTGCCACCCGGACTGATCTTGTCTACTTTGACAACTCTCCAGAT
TACTGTGTCTTGGACAAGGCTGCAG
gtgagtaaggaaggcaggcagggacatgcagtcccagttcttagtgcaggcacccctggt
taatcatggtctgttcagtctcaggagttagggaagggggtgctgtgggaggaggcagtt
tcctctccacatgaacacctggtcatgagattgttgcagtccaccaggcccagtgctgcc
EXON 5  1004 bp
ggactcaaggattccttctgccttggccttccaaaatgctgggatgataggcatgagtga
gccactgtgcccagcccaaaaaagcgattctttttatcttccttctgagaatgtggttaa
gggtatccagggcagctgaagagataactttgttctcactccctctcttccccaacccag
GTTCCCTAGGCACTGCAGGCCGTGTCTGCAGCAAGACATCAAAAGGAACAGACGGTTGTG
AAATCATGTGCTGTGGCCGAGGGTACGACACAACTCGAGTCACCCGTGTTACCCAGTGTG
AGTGCAAATTCCACTGGTGCTGTGCTGTACGGTGCAAGGAATGCAGAAATACTGTGGACG
TCCATACTTGCAAAGCCCCCAAGAAGGCAGAGTGGCTGGACCAAACCTGAACACACAGAT
ACCTCACTCATCCCTCCAATTCAAGCCTCTCAACTCAAAAGCACAAGATCCTTGCATGCA
CACCTTCCTCCACCCTCCACCCTGGGCTGCTACCGCTTCTATTTAAGGATGTAGAGAGTA
ATCCATAGGGACCATGGTGTCCTGGCTGGTTCCTTAGCCCTGGGAAGGAGTTGTCAGGGG
ATATAAGAAACTGAGCAAGCTCCCTGATTTCCCGCTCTGGAGATTTGAAGGGAGAGTAGA
AGAGATAGGGGGTCTTTAGAGTGAAATGAGTTGCACTAAAGTACGTAGTTGAGGCTCCTT
TTTTCTTTCCTTTGCACCAGCTTCCCGATACTTCTTGGTGTGCAAGAGGAAGGGTACCTG
TAGAGAGCTTCTTTTTGTTTCTACCTGGCCAAAGTTAGATGGGACAAAGATGAATGGCAT
GTCCCTTCTCTGAAGTCCGTTTGAGCAGAACTACCTGGTACCCCGAAAGAAAATCTTAGG
CTACCACATTCTATTATTGAGAGCCTGAGATGTTAGCCATAGTGGACAAGGTTCCATTCA
CATGCTCATATGTTTATAAACTGTGTTTTGTAGAAGAAAAAGAATCATAACAATACAAAC
ACACATTCATTCTCTCTTTTTCTCTCTACCATTCTCAACCTGTATTGGACAGCACTGCCT
CTTTTGCTTACTTGCTGCCTGTTCAAACTGAGGTGGAATGCAGTGGTTCCCATGCTTAAC
AAATCATTAAAACACCCTAGAACACTCCTAGGATAGATTAATGT
agtaagtctggctaggccttgtgttgccttttttttttttttttttttcttttcttttct
tctcttcccatgcactattctggaggtttgccaggtttggggagacatggagtaaaagaa
agataggcaactcatggatggtgggagagcaggtaagcaggtctgatctcaagggcccac