Gene WNT2B Variant 1
DNA : 53.87 KbNT_019273
mRNA : 2013 bp NM_004185
CDS : 1119 bp NP_004176
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  174 bp
tcaggagaagtaagcaggaactcgacaggaaagggcatggtctgcccaggcaaagaattt
gtgcccttatttggtgggccactggaagcctgaattgaggagcatcatgagcacaggcac
atttaccaagaagctaatgaggtttaagcttcgaggcccatcactggcatggccccttcc
AAACCCTGAAGAGCCCAAGCAATGTGGTTGTAAAATTTGCAAAATAAGATTAAATCTTAA
CTGCAATCTGTTAACACTGCTGTCTCCTTTCACTCTTTCTCCTATATCACACTTTCCCAC
ATGTTGGATGGCCTTGGAGTGGTAGCCATAAGCATTTTTGGAATTCAACTAAAA
gtaagttgaatgaagcactactttatttaatacttgtacctaattttctccttttcttct
cgatacataatactttacatatttatggggtatatatgatcatatacgtagtatgtataa
tggtcaagcttgttatacacgtagtatgtataatggtcaagtcaggatatttggggtatc
EXON 2  71 bp
ttgtatttcaaatcctactcatctatcaaggtctaggccaaaatttacctcttccggaaa
gatcccccctggattcccaatagctctaccctaaataaatctacaaatcactcctcttcc
tgctgaaaatccatagcatttattatgttaaattgcgcctgtgttttcttttccgaccag
ACTGAAGGATCCTTGAGGACGGCAGTACCTGGCATACCTACACAGTCAGCGTTCAACAAG
TGTTTGCAAAG
gtacatgataattaaaatgtcagataaccaattataaaaaataaattggcctgcacggtg
gctcgtgcctgtaatcccagcactttcagaggctgaggcgggtggatcacaagggcaaga
gttcgagaccagcctggccaacatggtgaaactccgtctctaccaaaaatacaaaaatta
EXON 3  221 bp
ctattaatacttcttcagaactgtgggaaatggttctactcatcagctttatggaatgtg
ggttagggagaggggacagaatctcttcaaggtctggatgctaaacgtaccccttcctta
ttccctcccaatgcagaaaaaggtctgggatgttctgacagggccatctctgccttgcag
GTACATTGGGGCACTGGGGGCACGAGTGATCTGTGACAATATCCCTGGTTTGGTGAGCCG
GCAGCGGCAGCTGTGCCAGCGTTACCCAGACATCATGCGTTCAGTGGGCGAGGGTGCCCG
AGAATGGATCCGAGAGTGTCAGCACCAATTCCGCCACCACCGCTGGAACTGTACCACCCT
GGACCGGGACCACACCGTCTTTGGCCGTGTCATGCTCAGAA
gtaagagcctcttccatcctgtgtcagctccttccctttctgtgctgggggtggtgagtg
ggaagagtaggcaagatctcccctctcctctcccacacactgtttcatcatcagagaaag
aactgtgggcagagcccaggatataattgggaacagactcttagcatcttagatttgtag
EXON 4  278 bp
ggtcagatactctggggaatgctcttggaaatgaaaggcaccttgaataaagggggtgta
ggggtgactctgggaaagaaaattagggaagaggtttcagagtcagaggttgtatgggct
gaagaaggggacagacatgggcctctttcctgaagcacacctctacaattctctctctag
GTAGCCGAGAGGCAGCTTTTGTATATGCCATCTCATCAGCAGGGGTAGTCCACGCTATTA
CTCGCGCCTGTAGCCAGGGTGAACTGAGTGTGTGCAGCTGTGACCCCTACACCCGTGGCC
GACACCATGACCAGCGTGGGGACTTTGACTGGGGTGGCTGCAGTGACAACATCCACTACG
GTGTCCGTTTTGCCAAGGCCTTCGTGGATGCCAAGGAGAAGAGGCTTAAGGATGCCCGGG
CCCTCATGAACTTACATAATAACCGCTGTGGTCGCACG
gtcagtactcatgtctgtgtaagtacactcatatttgctgggggtgaccagtgtgtgtga
ccatggactaaataaatgtgaagatggaagagctgaaggcttctgggtcacttccaaaag
ccccaacatcctgggacaggagaactaaatgcaagggagcttaggaatgcctagggtcaa
EXON 5  265 bp
tttcttgaacttgatcaggaagaatgggtgggatctgatgtgggagagaaccgagagctc
aatcggccagccagggccaggtccagcctatctcagagcactcatccttttggacctagg
gatgactaaaatgtgtcctgaccagctacttctcccttaactgccttccccctcccccag
GCTGTGCGGCGGTTTCTGAAGCTGGAGTGTAAGTGCCATGGCGTGAGTGGTTCCTGTACT
CTGCGCACCTGCTGGCGTGCACTCTCAGATTTCCGCCGCACAGGTGATTACCTGCGGCGA
CGCTATGATGGGGCTGTGCAGGTGATGGCCACCCAAGATGGTGCCAACTTCACCGCAGCC
CGCCAAGGCTATCGCCGTGCCACCCGGACTGATCTTGTCTACTTTGACAACTCTCCAGAT
TACTGTGTCTTGGACAAGGCTGCAG
gtgagtaaggaaggcaggcagggacatgcagtcccagttcttagtgcaggcacccctggt
taatcatggtctgttcagtctcaggagttagggaagggggtgctgtgggaggaggcagtt
tcctctccacatgaacacctggtcatgagattgttgcagtccaccaggcccagtgctgcc
EXON 6  1004 bp
ggactcaaggattccttctgccttggccttccaaaatgctgggatgataggcatgagtga
gccactgtgcccagcccaaaaaagcgattctttttatcttccttctgagaatgtggttaa
gggtatccagggcagctgaagagataactttgttctcactccctctcttccccaacccag
GTTCCCTAGGCACTGCAGGCCGTGTCTGCAGCAAGACATCAAAAGGAACAGACGGTTGTG
AAATCATGTGCTGTGGCCGAGGGTACGACACAACTCGAGTCACCCGTGTTACCCAGTGTG
AGTGCAAATTCCACTGGTGCTGTGCTGTACGGTGCAAGGAATGCAGAAATACTGTGGACG
TCCATACTTGCAAAGCCCCCAAGAAGGCAGAGTGGCTGGACCAAACCTGAACACACAGAT
ACCTCACTCATCCCTCCAATTCAAGCCTCTCAACTCAAAAGCACAAGATCCTTGCATGCA
CACCTTCCTCCACCCTCCACCCTGGGCTGCTACCGCTTCTATTTAAGGATGTAGAGAGTA
ATCCATAGGGACCATGGTGTCCTGGCTGGTTCCTTAGCCCTGGGAAGGAGTTGTCAGGGG
ATATAAGAAACTGAGCAAGCTCCCTGATTTCCCGCTCTGGAGATTTGAAGGGAGAGTAGA
AGAGATAGGGGGTCTTTAGAGTGAAATGAGTTGCACTAAAGTACGTAGTTGAGGCTCCTT
TTTTCTTTCCTTTGCACCAGCTTCCCGATACTTCTTGGTGTGCAAGAGGAAGGGTACCTG
TAGAGAGCTTCTTTTTGTTTCTACCTGGCCAAAGTTAGATGGGACAAAGATGAATGGCAT
GTCCCTTCTCTGAAGTCCGTTTGAGCAGAACTACCTGGTACCCCGAAAGAAAATCTTAGG
CTACCACATTCTATTATTGAGAGCCTGAGATGTTAGCCATAGTGGACAAGGTTCCATTCA
CATGCTCATATGTTTATAAACTGTGTTTTGTAGAAGAAAAAGAATCATAACAATACAAAC
ACACATTCATTCTCTCTTTTTCTCTCTACCATTCTCAACCTGTATTGGACAGCACTGCCT
CTTTTGCTTACTTGCTGCCTGTTCAAACTGAGGTGGAATGCAGTGGTTCCCATGCTTAAC
AAATCATTAAAACACCCTAGAACACTCCTAGGATAGATTAATGT
agtaagtctggctaggccttgtgttgccttttttttttttttttttttcttttcttttct
tctcttcccatgcactattctggaggtttgccaggtttggggagacatggagtaaaagaa
agataggcaactcatggatggtgggagagcaggtaagcaggtctgatctcaagggcccac