Gene TP73 Variant 1
DNA : 80.73 KbNT_004321
mRNA : 2234 bp NM_005427
CDS : 1911 bp NP_005418
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  77 bp
gccgcgactcggtggcccgcgctgccttcccgcgcgccgggctaaaaaggcgctaacgcc
cgcggccgcctactccccgcggcgcctcccctccccgcgcccatataacccgcctagggg
ccgggcagcccgccctgcctccccgcccgcgcacccgcccggaggctcgcgcgcccgcga
AGGGGACGCAGCGAAACCGGGGCCCGCGCCAGGCCAGCCGGGACGGACGCCGATGCCCGG
GGCTGCGACGGCTGCAG
gtaggaggcccagggccggggggcggttcggctccgcgggcgggggctggagcgcagcgc
tgggcaggcacctgggctcgcagctccgaagctgggaggtgaggggagagcgatcgggga
cgagctgggacaaggcgacacaggggctccctcggagttggatcggcccctgggacttgg
EXON 2  98 bp
ccgcggggaacagggtggacgaaatgacagtggagagggcacagggagggcaaggcgggg
gcacctgctccagggatgccccaggcaggcccacttgcctgccgcccccaccgaggctgt
cacaggaggacagagcacgagttcccagggtgctcaggtgtcattccttccttcctgcag
AGCGAGCTGCCCTCGGAGGCCGGCGTGGGGAAGATGGCCCAGTCCACCGCCACCTCCCCT
GATGGGGGCACCACGTTTGAGCACCTCTGGAGCTCTCT
gtgagtgcgcttggctggccagagctgggggcccccctgggaggcactctgggctagcct
cagccaccttcgctgggctaactgggccagagcaggaggggtggccccgggaggactctg
ggctagccccagccaccctcactgagactttgggctaaacttggcaaccctcactgggat
EXON 3  121 bp
actcacagcagccctggaatggcaggtggaggacagagatgggatgagagggaatgggaa
gggcaggagacgtaggcctcaccaggagtctcaggctagccttgagctctgggcctggga
ggtattggggtgacacccaaactggggactgacgcttctattttcctctccctgccccag
GGAACCAGACAGCACCTACTTCGACCTTCCCCAGTCAAGCCGGGGGAATAATGAGGTGGT
GGGCGGAACGGATTCCAGCATGGACGTCTTCCACCTGGAGGGCATGACTACATCTGTCAT
G
gtgagtgggggggctgccctctgcaagaggactggagtggggacaacaaatgtggcctgt
cctgtcttgggagcctggcagaaccaggagatagcctcttggttgtacagcttcccctgt
gggtttctgaggacacttcaaattgcaaaggagaaaatgtatcagctcatgtaactgtca
EXON 4  243 bp
tatgtcagtttatcccaatgcaagtagtggcctgttgggatgggggagagacccggggaa
atatttgggatgactggagccgctggccctttaaggctcctgtaacaggacacctcctag
acgggacaggacgactgactgtgtgtgtttccccctccctcctcccctttcccgcgccag
GCCCAGTTCAATCTGCTGAGCAGCACCATGGACCAGATGAGCAGCCGCGCGGCCTCGGCC
AGCCCCTACACCCCAGAGCACGCCGCCAGCGTGCCCACCCACTCGCCCTACGCACAACCC
AGCTCCACCTTCGACACCATGTCGCCGGCGCCTGTCATCCCCTCCAACACCGACTACCCC
GGACCCCACCACTTTGAGGTCACTTTCCAGCAGTCCAGCACGGCCAAGTCAGCCACCTGG
ACG
gtgagttcccctagtccctgagggctgcgggctgcgggctgcgggctggagaggaggtgg
ctgcgttccccgcacctcaagaggtctgagctcgccccactgtctgctcggggttcccac
ctggcccgggccaggaggagcatcgggcaggaggcgggtctcagggccgggcagtctggg
EXON 5  187 bp
ttcacgcctcaaaggacagacacctggagggattcagcagaggggctgcttggggcagtc
ttcatctgggggttgtggaaggggcacccatggggaggacgtggctcccaatggggggtg
gcctggacaggggtgcagttgggaccactggtctcacccgctccctctcccccactccag
TACTCCCCGCTCTTGAAGAAACTCTACTGCCAGATCGCCAAGACATGCCCCATCCAGATC
AAGGTGTCCACCCCGCCACCCCCAGGCACCGCCATCCGGGCCATGCCTGTTTACAAGAAA
GCGGAGCACGTGACCGACGTCGTGAAACGCTGCCCCAACCACGAGCTCGGGAGGGACTTC
AACGAAG
gtgagggcccccagctcctctgcccacggtggcactttgcccagcatcccggacagcaca
gccgggggctgcctaactgggagagagtggggctgacagcatgggcttagccattcccct
gcggagggctttcagtgcctccaccagcccccattttcccagttctgagtgggacctggg
EXON 6  116 bp
tctgcacctgacatggggctgggcacttctttgaacctggcacggggctgggtacctctc
tgcacctgacatggggctgggcaccctttgaacccggcacagggctgggcacctctctgc
acctagcacaggggtgggcacctctatgcacctctctgaagtgtcgacccctcccggcag
GACAGTCTGCTCCAGCCAGCCACCTCATCCGCGTGGAAGGCAATAATCTCTCGCAGTATG
TGGATGACCCTGTCACCGGCAGGCAGAGCGTCGTGGTGCCCTATGAGCCACCACAG
gtaggccaggagccaggctgtgcccagggccctgcagtcagctgtacgggtcgggggagg
ggtcccctgaggcagcccctgtccctcctcagttggctgatctgcctgcctgtcctgtcg
gcatctgtccagggctccctgctctgtgataagtctgtgtcggcggctccttcctcaccc
EXON 7  110 bp
atggggtgggttggtggatggatgaatgagtggacagatatacaaatggcaacaactata
gagcagggcatccccctgcctacgtggagccaggaccagacatggagctgggggctgcca
ccttagtggattggggctgcgtgctgatgctagcccctctccctgctcccccatgtgcag
GTGGGGACGGAATTCACCACCATCCTGTACAACTTCATGTGTAACAGCAGCTGTGTAGGG
GGCATGAACCGGCGGCCCATCCTCATCATCATCACCCTGGAGATGCGGGA
gtgagtcccgggcacacggggtggaggtgggacagggctgggcaggcacggccgggggag
aaggggagctgtcatggagacctgcaggccaaggctagcttggggaagagactttggggt
gtgctgctggaggaaggaaccgccccctggcctgcagggcctgcctgggcacaagctggg
EXON 8  143 bp
cctcacagctttgagcctctgactccctctagcgggaacactcgctgccggcactgggtg
ctctgtggtgaccgagggctctcaaggccggtcctgcagggtccgaggtgggtggggaag
gtgggcaggttgagggtgggcagggttgagctcacaattctggctgtgcccacccgacag
TGGGCAGGTGCTGGGCCGCCGGTCCTTTGAGGGCCGCATCTGCGCCTGTCCTGGCCGCGA
CCGAAAAGCTGATGAGGACCACTACCGGGAGCAGCAGGCCCTGAACGAGAGCTCCGCCAA
GAACGGGGCCGCCAGCAAGCGTG
gtgagcggccggccaggggaactggacgcgtgtgggaggagaaggggacacattggcagg
acacaatgtgagcccgcgtcccagggacagggccagtccctgaacggccccccacgccca
gactcctccctgacggagcctgagagcagcccccatataagtcgcttgtcctgggccaag
EXON 9  89 bp
agggcacctcagaggcctgggtggcaccgcaggtttgcccgtccctgtgggttgctcacc
accggacccacctggagaatcgattggccccaagggtggggcaggtctccctcctcccgg
aaggaggcctcaccctctggtcctgcctgctcaccccgcctgccctgcctggccttccag
CCTTCAAGCAGAGCCCCCCTGCCGTCCCCGCCCTTGGTGCCGGTGTGAAGAAGCGGCGGC
ATGGAGACGAGGACACGTACTACCTTCAG
gtgagtgtgtgctcctgcacggcagccgggagacctgcctcacctctgtcgtctgctgag
cccaggctgggccatggggagggactctggagaccatggtggagggggcgggaggagccc
agccctgtgtgagagggtccagagggcagaacctgcttgcaagagccagaccagcaggac
EXON 10  122 bp
ggttagacctgcttcttgggaagaggaaagaagatcaggggatcctgagcctctggggtg
ctggggaacccccagaaaggacagatgctttgccaagcccaggtcctcctgaggctgcgg
ccacccccctcccgtgggggtctggggcacgtgggcagagatctgctcctctgtgctcag
GTGCGAGGCCGGGAGAACTTTGAGATCCTGATGAAGCTGAAAGAGAGCCTGGAGCTGATG
GAGTTGGTGCCGCAGCCACTGGTGGACTCCTATCGGCAGCAGCAGCAGCTCCTACAGAGG
CC
gtgagtcagccctagcccaccatcagtgtggggaaggaggacatggcttaaccccccagg
agaaggccaggaggaccagaaacccctccagaaggcatcatctgccagggacaggcagca
gggtccagagcagagcccaccccacatctcctcctccaggaagccttctagcacttgggg
EXON 11  149 bp
cgcaggcccagtggccgtgcatggccatggttggggacagggaggctgggggaggatgaa
gccactctctgacatcagaggctccacccattcgcagcatgggggcatcacgggcatggg
tggtcggtgggcacgaggctgccttgcttcccacccatgcgagccgttgcttctgagcag
GAGTCACCTACAGCCCCCGTCCTACGGGCCGGTCCTCTCGCCCATGAACAAGGTGCACGG
GGGCATGAACAAGCTGCCCTCCGTCAACCAGCTGGTGGGCCAGCCTCCCCCGCACAGTTC
GGCAGCTACACCCAACCTGGGGCCCGTGG
gtgagtcccttgggcagtgcgggcccacgggcagggcggggaggcccactgggggcgcct
agctcaggacacaccacccagctcgggacccagggcaggtgtctctgtggctggctcctt
ccagcggttccaccctctgggcaggaggcgcagccacggatagccctctctgcccactcc
EXON 12  139 bp
acagggccccaggtgttcagcccttgctcaagcctctagctggcaggggtgatgcccagc
gtcacatcgccaggccttgggatggctccctggtgtccagaggtgtctggagcctgggtg
gaggctgcacctggatgcccagcctggctgccctgatggccccacctgcctctcacccag
GCCCCGGGATGCTCAACAACCATGGCCACGCAGTGCCAGCCAACGGCGAGATGAGCAGCA
GCCACAGCGCCCAGTCCATGGTCTCGGGGTCCCACTGCACTCCGCCACCCCCCTACCACG
CCGACCCCAGCCTCGTCAG
gtgcgtgggctgccgagggcctgagcatgtgctgtcaccctgtctgttcacctctgtcct
tctggccatgtcagctgccctgccccaccctgtgtgctcaccactcgcaaccctggatca
gacaggcgggcgggggcagtcaggccaggagcatctgcagatgctggggaaatggtccac
EXON 13  94 bp
acctgtccccagctgagcacgtcccctccctgagggatgccgtggccacctgtgggctgg
agccacccttcggagacagcggcagtctccgccccagccaggccactctcagagatgggg
gctcgcgcagccctgtgctcggaagctaatgctgcttcctttctcaaattctctctgcag
TTTTTTAACAGGATTGGGGTGTCCAAACTGCATCGAGTATTTCACCTCCCAAGGGTTACA
GAGCATTTACCACCTGCAGAACCTGACCATTGAG
gtaacgcccgggtggaccccgctctgcagaggcagtagctggaggggcccctgtccggag
ggcaaagagccttctcttccttgctctcgtggctgggaaacttggaaaccctttcccacg
ggcaagcagatgcgatgatttgactcttgagagcttaggcagatgcagccaggcacgtgg
EXON 14  546 bp
caggccccgcacaggccaggagtgactctggtgggctctccccctcccccgtctcctgcc
tactctggttgggggtgtaggggccagggtgtggtgtggccagacctccaggcccagggc
gaccccccctgctctccctgctccactgccccctgcccctaatgcgccggcctctcgcag
GACCTGGGGGCCCTGAAGATCCCCGAGCAGTACCGCATGACCATCTGGCGGGGCCTGCAG
GACCTGAAGCAGGGCCACGACTACAGCACCGCGCAGCAGCTGCTCCGCTCTAGCAACGCG
GCCACCATCTCCATCGGCGGCTCAGGGGAACTGCAGCGCCAGCGGGTCATGGAGGCCGTG
CACTTCCGCGTGCGCCACACCATCACCATCCCCAACCGCGGCGGCCCAGGCGGCGGCCCT
GACGAGTGGGCGGACTTCGGCTTCGACCTGCCCGACTGCAAGGCCCGCAAGCAGCCCATC
AAGGAGGAGTTCACGGAGGCCGAGATCCACTGAGGGCCTCGCCTGGCTGCAGCCTGCGCC
ACCGCCCAGAGACCCAAGCTGCCTCCCCTCTCCTTCCTGTGTGTCCAAAACTGCCTCAGG
AGGCAGGACCTTCGGGCTGTGCCCGGGGAAAGGCAAGGTCCGGCCCATCCCCAGGCACCT
CACAGGCCCCAGGAAAGGCCCAGCCACCGAAGCCGCCTGTGGACAGCCTGAGTCACCTGC
AGAACC
ttctggagctgccctagtgctgggcttgtggggcgggggctggcccactctcagccctgc
cactgccccggcgtgctccatggcaggcgtgggtggggaccgcagcgtcggctccgactt
ccaggcttcatcctagagactgtcatctcccaaccaggcgaggtccttccaaaggaaagg