Gene TNR Variant 1
DNA : 84.00 KbNT_004487
mRNA : 4716 bp NM_003285
CDS : 4077 bp NP_003276
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  580 bp
agtgtccattttcaggggtccagtcctttaaggaacaaagtcctgggcctttatgacatt
ggcagccactgtcccttcctgacgccccccccttgaaaatctctggctgcctactcctga
gctttgtaggcttgtgcagagccatggtgccaaggcataggtctcagaggttgtctcttt
CCTTGGTTTCCGTTGCAGATTCCCACAACTCCATGCTGTGTGCTGCAGGCTGGTCCTGAA
CCCAGATCTCTGGCTGAGAGGATGGGGGCAGATGGGGAAACAGTGGTTCTGAAGAACATG
CTCATTGGCATCAACCTGATCCTTCTGGGCTCCATGATCAAGCCTTCAGAGTGTCAGCTG
GAGGTCACCACAGAAAGGGTCCAGAGACAGTCAGTGGAGGAGGAGGGAGGCATTGCCAAC
TACAACACATCCAGCAAAGAGCAGCCTGTGGTCTTCAACCACGTGTACAACATTAACGTG
CCCTTGGACAACCTCTGCTCCTCAGGGCTAGAGGCCTCTGCTGAGCAGGAGGTGAGTGCA
GAAGACGAGACTCTGGCAGAGTACATGGGCCAGACCTCAGACCACGAGAGCCAGGTCACC
TTTACACACAGGATCAACTTCCCCAAAAAGGCCTGTCCATGTGCCAGTTCAGCCCAGGTG
CTGCAGGAGCTGCTGAGCCGGATCGAGATGCTGGAGAGGGAGGTGTCGGTGCTGCGAGAC
CAGTGCAACGCCAACTGCTGCCAAGAAAGTGCTGCCACAG
gtagagtccgggagctcgcagcgtggtctcaggaggggaaggagagggctgagcagagag
ggagagtgaacaagaaggaccaatgcacttccagcgaaaacgcactcccagcaaaacccc
ggcatctcttcacacggtcaaaggaaaaaagtgtcctagtctgtagctgccggttaatat
EXON 2  477 bp
cagcccatgctaggtgaaaatatttattaaattgaatatgtaccaaactacgttgagctt
cactctcagcaacagaaatctggtcagagaatgagtagagaggcctttgcccatccttcc
ccagcaccattgacaggagaggccactgctgctctttgaccttctccttgaccattccag
GACAACTGGACTATATCCCTCACTGCAGTGGCCACGGCAACTTTAGCTTTGAGTCCTGTG
GCTGCATCTGCAACGAAGGCTGGTTTGGCAAGAATTGCTCGGAGCCCTACTGCCCGCTGG
GTTGCTCCAGCCGGGGGGTGTGTGTGGATGGCCAGTGCATCTGTGACAGCGAGTACAGCG
GGGATGACTGTTCCGAACTCCGGTGCCCAACAGACTGCAGCTCCCGGGGGCTCTGCGTGG
ACGGGGAGTGTGTCTGTGAAGAGCCCTACACTGGCGAGGACTGCAGGGAACTGAGGTGCC
CTGGGGACTGTTCGGGGAAGGGGAGATGTGCCAACGGTACCTGTTTATGCGAGGAGGGCT
ACGTTGGTGAGGACTGCGGCCAGCGGCAGTGTCTGAATGCCTGCAGTGGGCGAGGACAAT
GTGAGGAGGGGCTCTGCGTCTGTGAAGAGGGCTACCAGGGCCCTGACTGCTCAGCAG
gtaggcaggggaactctctggggtgtttggcaagggtggtccagcaaactagctggatgc
ctccagttagcttgggaagaaagatgagtgagaaagtgaagtttaggcaaaataattctc
aattgagttgtactcatttgctttccaagagagctgagttcttgagtcttgatgaggcag
EXON 3  264 bp
actaagcaccaaaaagacaagagcctgctcacaaaggaagttacaaatcacttaaagcca
ttgagcccagcaggacatatagacatggcatggggggtgagatgtgaggaagaaagttga
gtccaggatggggaaggcaatcctctgagctcatgctatctgtgtattgcctcccggtag
TTGCCCCTCCAGAGGACTTGCGAGTGGCTGGTATCAGCGACAGGTCCATTGAGCTGGAAT
GGGACGGGCCGATGGCAGTGACGGAATATGTGATCTCTTACCAGCCGACGGCCCTGGGGG
GCCTCCAGCTCCAGCAGCGGGTGCCTGGAGATTGGAGTGGTGTCACCATCACGGAGCTGG
AGCCAGGTCTCACCTACAACATCAGCGTCTACGCTGTCATTAGCAACATCCTCAGCCTTC
CCATCACTGCCAAGGTGGCCACCC
gtacgtaccatttccccgtcctgcttcatttttcttttctcctacatgagatcatgggca
ttcatgatagtagcgtcttttcttagttcttcagggatgcctggaatagttattgccctt
gaggggaagggctagagatgtgacccatttagaaagggtacatcattaaaaaggcacttt
EXON 4  116 bp
ccacatggggtgggttgattctgcacctgggactcactgtgtctggagcaagattgggat
tgtccaccagacaccaccacgcccatggcgtggagggagttcaccaagacaaagcaccag
gcaatgctgtctgtcccaagggttagccatgacattgtcacctacattgctgtgttccag
ATCTCTCCACTCCTCAAGGGCTACAATTTAAGACGATCACAGAGACCACCGTGGAGGTGC
AGTGGGAGCCCTTCTCATTTTCCTTCGATGGGTGGGAAATCAGCTTCATTCCAAAG
gtaacactcacctgttacactgccaaacagacttatttggaatatttgtacctttagctt
ggaatcaggggcagcaaggaaagtgctacccaatatctctctccatgccattaaagacac
aaaatggcatgttgtgggtgtctgggatatagaacatttctgtgacaaatatgtggtaac
EXON 5  151 bp
gagtctatggggagttatttctggccccagatactcagctgtcagcatggaggaaagaga
catcgcccccattttaaattcacaatccacaattagtattccacacctttatctttctct
catcagatttctctcccagtgacttttctcttttgctctctgcttctccccactgtccag
AACAATGAAGGGGGAGTGATTGCTCAGGTCCCCAGCGATGTTACGTCCTTTAACCAGACA
GGACTAAAGCCTGGGGAGGAATACATTGTCAATGTGGTGGCTCTGAAAGAACAGGCCCGC
AGCCCCCCTACCTCGGCCAGCGTCTCCACAG
gtgagtgcctccaacccttctccctagagctgcctactaggtcacttggaaaagaaccac
agaattgcccaaggagtggagagacaacagaggtgctagaatttctcctagagctgggac
aattctggtacctggcaatggagctactctaccagatgcttagctcatcatcttccctat
EXON 6  270 bp
catgtcctcaggaaagatattcatcttactgtgtctcattttcctcatctgtaaaatgca
gtaacaatacccatcctctctctgactcaccagacttccataaggaggaaaagagagagc
tgacacccaaggcttatttctcattcaaactttttgttctgtttgatccttctcactcag
TCATTGACGGCCCCACGCAGATCCTGGTTCGCGATGTCTCGGACACTGTGGCTTTTGTGG
AGTGGATTCCCCCTCGAGCCAAAGTCGATTTCATTCTTTTGAAATATGGCCTGGTGGGCG
GGGAAGGTGGGAGGACCACCTTCCGGCTGCAGCCTCCCCTGAGCCAATACTCAGTGCAGG
CCCTGCGGCCTGGCTCCCGATACGAGGTGTCAGTCAGTGCCGTCCGAGGGACCAACGAGA
GCGATTCTGCCACCACTCAGTTCACAACAG
gtaaggctgcggtgggggagagacgcacaaggagggaaagaggggtggagccaaccggtg
gtgtcatcacagcaagaggagtattaggaatgaggcaaggtgtgtcagagcattggcctt
gtcatagacaccgcgagaaggaagcaagaggtttccagcatacaggaaaagcagcgctcc
EXON 7  186 bp
gcccaaggaatttgtcacagcagaccaaaaagctaagggtagccacagtgttcattcaaa
tgtgagccagagggtcagggggtgtgggctgtcaccaccaatcttttcagagttcaagat
gcaccacaaatgtacattacattatcatgtgcgatgttggtgatgtctgtctatttttag
AGATCGATGCCCCCAAGAACTTGCGAGTTGGTTCTCGCACAGCAACCAGCCTTGACCTCG
AGTGGGATAACAGTGAAGCCGAAGTTCAGGAGTACAAGGTTGTGTACAGCACCCTGGCGG
GTGAGCAATATCATGAGGTACTGGTCCCCAGGGGCATTGGTCCAACCACCAGGGCCACCC
TGACAG
gtgagtaagacctatctcttggggttatgctggttgctgagtctataccctcacagctgt
ctccccaacctacacatcttacaaacccatggccaattcctattgatctcatctcttaag
tgcctagcacatatgtctagtactatccattgtactgccatcacctgttctaagctacta
EXON 8  90 bp
ttgacttgggattcctaaatagtgaaattgggatttcttaatagttcaaattaggagagg
attcaaggaggactaaacacaagatatgaataggagtctaagatcattttcttcccactt
tcagccttcctagccctgccccatacacagaataatgtttgtttctccatccactgatag
ATCTGGTACCTGGCACTGAGTATGGAGTTGGAATATCTGCCGTCATGAACTCACAGCAAA
GCGTGCCAGCCACCATGAATGCCAGGACTG
gtgagtaggaggactgctgaggaagaagaccaggttagcctataagcctaaggagtcatg
gaggctcgtcccagcaaaaattaatcagaaagcaatgtcttccagtgaacagggctctgg
tgacaactgtcagcctagaaacaacatccaccctatgcctaatccttgatctctgacagg
EXON 9  264 bp
gcccctggccatcattcagagggaaggtacttagcaaaatattagataagtgtcagcaat
gacaagctagtgctcatagtcagcaggcctgctgatagcttggaaacacacaaagcaggc
caataaatactgccctccaggggaacacatgtaaaataggccatttatgtcaatccacag
AACTTGACAGTCCCCGAGACCTCATGGTGACAGCCTCCTCGGAGACCTCCATCTCCCTCA
TCTGGACCAAGGCCAGTGGCCCCATTGACCACTACCGAATTACCTTTACCCCATCCTCTG
GGATTGCCTCAGAAGTCACCGTACCCAAGGACAGGACCTCATACACACTAACAGATCTAG
AGCCTGGGGCAGAGTACATCATTTCCGTCACTGCTGAGAGGGGTCGGCAGCAGAGCTTGG
AGTCCACTGTGGATGCTTTCACAG
gtaccagagcagcagaaatcccagccaggttcagggatcagtggatctcagtgtgagaaa
ttcattcaggcaagtcactcttccaatgttccatttcctttggagaaaagagaggtgggt
agaaaaggatagagtaaaaactaataagtgcatcaagagggaagggttggaagtaaagag
EXON 10  270 bp
ggattggaaaaagtggagtgaacagcactggagggtgaggaggtggaatctcttggttag
tgggtgaaggtgtggcccttattagcaaggagagcaggtccctttagccaagaagttctt
ctagcccagtgacccatctcctcacgtgtttcaggaccatccatctcctttgctttgcag
GCTTCCGTCCCATCTCTCATCTGCACTTTTCTCATGTGACCTCCTCCAGTGTGAACATCA
CTTGGAGTGATCCATCTCCCCCAGCAGACAGACTCATTCTTAACTACAGCCCCAGGGATG
AGGAGGAAGAGATGATGGAGGTCTCCCTGGATGCCACCAAGAGGCATGCTGTCCTGATGG
GCCTGCAACCAGCCACAGAGTATATTGTGAACCTTGTGGCTGTCCATGGCACAGTGACCT
CTGAGCCCATTGTGGGCTCCATCACCACAG
gtgaggctggaggacttggcagcaggtgatgaaaggggttttcacagtagcctttgacaa
atcaatgaaattttaaaagagaaagacccaaggagtaggggatttcctctatggctagag
aaagtctgtgacctgttctgaaacagctacttcctccagtgctgcagaagatgcattaga
EXON 11  120 bp
cctacaaggtttcaagtgaaacatcagcgtgaccatggttttaagataccctattacatg
gaaagatcttgtctgcctttgggacaacattggcttttggtcaacataaaaccagggatg
agaatttctttttcacactgtgctttctgtctttttcccacaatcactgggtccttgtag
GAATTGATCCCCCAAAAGACATCACAATTAGCAATGTGACCAAGGACTCAGTGATGGTCT
CCTGGAGCCCTCCTGTTGCATCTTTCGATTACTACCGAGTATCATATCGACCCACCCAAG

gtaacaaagtgatttgatttctcaaagatactaggatttgggtgaagattatgggagaac
tagcatatcccgcagaacatccactcctgcctgcgtttttcctcttctctgtggcatgct
gcatcagaatgagagtgggctggtgagcagccaagaaaccccacactcaccaatgcctct
EXON 12  147 bp
gagaccagtgtgcaaagcctcttcacactccaacattcccagcccatgaaccatgtatca
tccctccccactgagtgcggagtcccacacccatctgtgctttattgacatagactgtac
catgggctgcttggatgaaagggctgctgaattttaactgtagattcttctcttctccag
TGGGACGACTAGACAGCTCAGTGGTGCCCAACACTGTGACAGAATTCACCATCACCAGAC
TGAACCCAGCTACCGAATACGAAATCAGCCTCAACAGCGTGCGGGGCAGGGAGGAAAGCG
AGCGCATCTGTACTCTTGTGCACACAG
gtgggaatgtctccctgctgtgtcaagtcagaaccctggctgaagatctgggtgaagttg
ttcgggcttgtagaaaggttctggaggctaaggctccatttcggggtgctcctccaactc
actgtgtcttgcagggcaatttgcaatttctctcccccaatattcctccctaatactaaa
EXON 13  120 bp
ggagaaatggaagaggctgatggaaccagaagaggagaaagggaagaggtttctgctcac
ttctttgttttgtagagtgcagcagcagtcttgcaccatgagtggaacttctgagatcat
tccctgcatttctatcctgcagctcctcttatctgtaactgataatctattctgtttcag
CCATGGACAACCCTGTGGATCTGATTGCTACCAATATCACTCCAACAGAAGCCCTGCTGC
AGTGGAAGGCACCAGTGGGTGAGGTGGAGAACTACGTCATTGTTCTTACACACTTTGCAG

gtgggtgtctgcaggcctgcagatcaggcaggtgggaatggtgggaattggagctgcaga
ccagtatgatgtgaataaacaaaacattttttcaatctgaaggacagattagaaaagttc
ctacttcaggtatactatgaagccctcaagatatccccaaactctatgctgggcatcgtg
EXON 14  144 bp
atgatatgagatgagaggggaatccttgcaaagagtaagatactaagctagataacctat
gaaagatttttttccaaaattctctagtagtaaatccatgtgaaatacctttggatttgg
tagatctttcctaaactgagtagccttattcaacccttattcatattcatttgagttcag
TCGCTGGAGAGACCATCCTTGTTGACGGAGTCAGTGAGGAATTTCGGCTTGTTGACCTGC
TTCCTAGCACCCACTATACTGCCACCATGTATGCCACCAATGGACCTCTCACCAGTGGCA
CCATCAGCACCAACTTTTCTACTC
gtgagtacatggtcacctacatacccgtatccctggggacttttgtggaaatgatcagct
ttcttgtggtggactagattatcacttacaggctttggacagggcagctatgagctgttc
ttatttggactgactacagcccaaattcagtgaaactaagctgcaacttttggccagcag
EXON 15  131 bp
actgaatgattatcatctgacccaggagcaccctttatgctcctttccaagccagagcag
gggtcagcatgtgagcaatcctgagaccaaagaggtgggcaacagatacccatacctgaa
atcaagcagggggaggagctggagaggcaggcatgccctggcactttctcctctttgcag
TCCTGGACCCTCCGGCAAACCTGACAGCCAGTGAAGTCACCAGACAAAGTGCCCTGATCT
CCTGGCAGCCTCCCAGGGCAGAGATTGAAAATTATGTCTTGACCTACAAATCCACCGATG
GAAGCCGCAAG
gtgagattttgctggaaagggaaaagaccatttcttccaagtgaggccatgtggaaactg
actagtggagtgaccacaggacattggagggagggggaaggaagcaatccacaaggattg
ctcatcagcttcccatcaaggatacccagcctgctgttgatgagagagccctagtctgca
EXON 16  133 bp
catgggagctctcctctctgcttattggtgcagtaatccttattgtgggatggagaggat
gacaatggccattgcaatactgacctagctgcccatgggatttggacttcccttccctac
tttcccaaattgcaagccagttgctcccttccaccacccttcctttggctcattatacag
GAGCTGATTGTGGATGCAGAAGACACCTGGATTCGACTGGAGGGCCTGTTGGAGAACACA
GACTACACGGTGCTCCTGCAGGCAGCACAGGACACCACGTGGAGCAGCATCACCTCCACC
GCTTTCACCACAG
gtgagggagcatggccactttgatgccttcttctccacttcctgatgtttggctcatcag
cagcctctgctgagacttgctctgggagcagtttatcaaaaaagctcagttgcctcctcc
ttcttttcccctgtccaagcccctaccaggaaacctctcactaacaaggtaaccgcagga
EXON 17  152 bp
gtggaagggaaatccaagatgatgccaagtccccacacccacaccttgagctccgttgag
gatttcttacagctgttgatgatgtaccaggaggcctgctaagaccttctatgatccaag
gagctcttgtgcactgtgagagaaagaatcctttctggacattgtctattttccttgcag
GAGGCCGGGTGTTCCCTCATCCCCAAGACTGTGCCCAGCATTTGATGAATGGAGACACTT
TGAGTGGGGTTTACCCCATCTTCCTCAATGGGGAGCTGAGCCAGAAATTACAAGTGTACT
GTGATATGACCACCGACGGGGGCGGCTGGATT
gtaagtacaatctgtgctctccttgcacagaagcgtcctcagtgttctagtctacctagc
tcagcacctgccaagccaacttcaccatcctcctggccatccttttatcaccccccacat
gtccatcttggggctcctcattgccctcaaggcccatgttcagagtccaatcatatatct
EXON 18  97 bp
aaaaactgctgtgtaaatactgagctctgctctgaaatgttccttctttggacatctttg
tcattgcagatataaaacccagttatatcaattttacttatcacagtttattttccttag
catctctttgggttttgtttttttgtttgtttgttttttgtttttttatttccttcatag
GTATTCCAGAGGCGGCAGAATGGCCAAACTGATTTTTTCCGGAAATGGGCTGATTACCGT
GTTGGCTTCGGGAACGTGGAGGATGAGTTCTGGCTGG
gtaaagcctccttattgctttccattgatgtgcttctctggctttttgtccatctctctc
ctttttgtgtccatctgagattatcagaaaccctgtgtttgttgagaagctaacagctcc
tgaattgctttcagaacctcttgctctgtttagcttcactattgatctgtttttatctta
EXON 19  162 bp
ggaagaaattcagtctggcagggtccatttgataacaacctgtgaagcaccaagagcaaa
agcaatctggagtcccctcctcttccctgtaacatgttttgaagccacagacgcatttcc
ctcccattttccaaagctgctgggggccagtctcagtgcattttctgctcttctccacag
GGCTGGACAATATACACAGGATCACATCCCAGGGCCGCTATGAGCTGCGCGTGGACATGC
GGGATGGCCAAGAGGCCGCCTTCGCCTCCTACGACAGGTTCTCTGTCGAGGACAGCAGAA
ACCTGTACAAACTCCGCATAGGAAGCTACAACGGCACTGCGG
gtacctatggctcctgagcagaccccaaggacagtgggcatgggacaagagcccccagat
tctaggcgtaagctgcctcaggaagcagcagcacccacagagttccagcattcgctgctg
gccagggagaagaagggccatgccactgggaaccactggcactggtcccagctctccctg
EXON 20  164 bp
gtggttggccccaggggtaaggtggagtaagagttcagcacagccactctgagaaactgg
gtggaaatgaaaaggttccataagtggaagccaggtttgctggaagtgggtcaagtgtcc
agaaaatcctgataaagcagtgacaaatgggacagcctaatgaatgtatcttttttgcag
GGGACTCCCTCAGCTATCATCAAGGACGCCCTTTCTCCACAGAGGATAGAGACAATGATG
TTGCAGTGACTAACTGTGCCATGTCGTACAAGGGAGCATGGTGGTATAAGAACTGCCACC
GGACCAACCTCAATGGGAAGTACGGGGAGTCCAGGCACAGTCAG
gtaagcgatgctccacctctgctatgaatgagccagagctgtggaatccgtgctccctta
gctttatattttaaaagcacatgtgagtccttcatttccctttaaaaagaaatattttga
gtcttgagaaaaataatgcagacaatgggataagatcaggacagagtagaagccagagga
EXON 21  678 bp
aaagctagaaagagactctgcccctttcactttattgggaactcggccttgaagcttcat
gttagctgaaaatagctaaccccacattgtggattccctgttcccataattacccctttt
ttgaagtggggcgttccatggtgggggatgacctgacatgcttatctttctcacgcccag
GGCATCAACTGGTACCATTGGAAAGGCCATGAGTTCTCCATCCCCTTTGTGGAAATGAAG
ATGCGCCCCTACAACCACCGTCTCATGGCAGGGAGAAAACGGCAGTCCTTACAGTTCTGA
GCAGTGGGCGGCTGCAAGCCAACCAATATTTTCTGTCATTTGTTTGTATTTTATAATATG
AAACAAGGGGGGAGGGTAATAGCAATGTGTTTTGCAACATATTAAGAGTATGTGAAGGAA
GCAGGGATGTCGCAGGAATCCGCTGGCTAACATCTGCTCTTGGTTTCTGCTGCCCTGGAG
CCTGACCCTCAGTCTCCATTCTCCCTCCTACCCAGGCCTCCTCAACCTTCACCTCCTTTC
CCACCAAGGAGGAGAAGTAGGAAGTTTTCTTAAAGGGCCAATTCAAAGCCAAGTCGTGGG
GTGCAGATTGTTATGGTGACAGGCACACACATTTTTCTACCCTTCTTCTGAGATGTCCTC
TGCCTTCCAGGTATTTGTGATTTTGTCACAGCCTGACATGGCCAGGTTCTCACACTGGCC
CAGAGAAAAGAGCCTCAGCAAGAGAGTTTTGCCAACAATTCCCCTTAAAAGGAAACAGAT
CAACTACACCGCATCCCAACAACCCAGGTTCTTTTCCTTCCTTCCTTCCTTCCTCCCTTC
CTTCTTTCCTGCCTTCCC
tccttccctcctttctttcttgacagtatctcactcttgctcagtctggagtgcagtggt
gcaatctcagctcactacagcctcgacttcctgagcttaagtgatcctctcgtctcagcc
tcttgagtagctgggactacaggcatgagccaccatacctggctgatttttcttttattt