Gene THBS3 Variant 1
DNA : 12.29 KbNT_079484
mRNA : 3127 bp NM_007112
CDS : 2871 bp NP_009043
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  100 bp
gattctttcccagtgcccctggttcccagagctgatgatgcctccagggtgattggcagc
tctttgtttcagccccccctcacccgcctgctggccccccctccaattctgtccctccgc
cccccggctcctgctctctccgcctagccttttcccctcccagctgcctgcctgccaggg
GTAGTGAGCCGGCTGAGAGGCATGGAGACGCAGGAACTTCGGGGGGCCCTGGCTCTTCTC
CTCCTTTGCTTTTTCACATCTGCCAGTCAGGATCTGCAGG
gtaagcctgtctccatcctcttagaccgctctctgcttcttccccatttgccctcagccc
aagtagcagagaacatgtgggcaaggggagaggggaagagtccagaaattgagccagagg
aaaacttaagactgcctagagttggtgaaattatggcctggtggagaggagtgggcaccg
EXON 2  207 bp
tgcctcaacctcccaaggtgttgggattacaggtgcgagccaccatgcccagccaagggt
tgaattttgaggtgactaacgctgcctggtggtgggggtagggggtgatgtgggctcggg
ggagggcataccttagcatttgatcccattctctaaccttgataacccctgcctgaccag
TAATTGACCTGCTGACTGTGGGCGAGTCTCGGCAGATGGTAGCTGTGGCAGAGAAGATCC
GGACAGCCTTGCTCACTGCTGGGGACATCTACCTCTTATCCACCTTCCGCCTGCCCCCCA
AGCAGGGTGGTGTCCTCTTTGGCCTCTATTCTCGCCAAGACAACACTCGATGGCTGGAGG
CCTCTGTTGTAGGCAAGATCAACAAAG
gtgactggtgggcatctcctttcttgcaatggtgacctccttaagcactctccctcatcc
ctacttcccaagtgcttcctcattctccttggcctccattagggaccaaggtcccatcag
gctgtgcccagacatcaggggcacctggtatggggtgcttataaggtgctttaggagccc
EXON 3  257 bp
ctctaaagcaatttcaaaaacatttattgtgtacctattaaatacaaggtgttgagagcc
acatagtagaattagggataggggccctagagatgtggtatctagcagagttgatccaag
gctcagctgggaggcagggggtgggggatagcgcccatactgatctcccctcctgggcag
TACTGGTGCGATACCAGCGGGAGGATGGCAAAGTCCACGCCGTGAACCTACAGCAAGCGG
GCCTGGCTGATGGGCGCACACACACAGTTCTCCTGCGACTCCGAGGTCCCTCCAGACCCA
GCCCTGCCCTACATCTCTACGTGGACTGCAAACTGGGTGACCAACATGCAGGCCTTCCAG
CACTGGCCCCCATTCCTCCAGCGGAGGTCGATGGGCTGGAGATTAGGACTGGACAGAAGG
CGTATTTGAGGATGCAG
gtgagccgggaggagcctctgagttctgtggaaatagagtttgcaccagctggggaaggg
gttggtagaccttcccaccttactctgctgctatccccccagggctttgtggaatctatg
aaaattattctgggtgggtccatggcccgggtaggagccctgagtgagtgtccattccaa
EXON 4  103 bp
gcactggcccccattcctccagcggaggtcgatgggctggagattaggactggacagaag
gcgtatttgaggatgcaggtgagccgggaggagcctctgagttctgtggaaatagagttt
gcaccagctggggaaggggttggtagaccttcccaccttactctgctgctatccccccag
GGCTTTGTGGAATCTATGAAAATTATTCTGGGTGGGTCCATGGCCCGGGTAGGAGCCCTG
AGTGAGTGTCCATTCCAAGGGGACGAGTCCATCCACAGTGCAG
gtaacacagagacttgtttgctgacattggaccacggatcctgtggcctttggtgactcc
tgtcttcttgatctccctctcccttaaaacccattcctttggctcacctgttcctagggt
ttctaaccctgttattccaaatctttcacctgactccacaatctccaatacacccatccg
EXON 5  27 bp
ccccatagaaggagctggcactgcttgtctgccagctctgccctcccagcatccagcacc
ccatctttattctggggctccagccctgtccctgtcctcaccttccttcctccttctcac
caaccaggcctctcttcacttcacctcacccctctgactatgttttcttctcctctccag
TGACCAATGCACTGCACTCCATTCTAG
gtgagtaggccacactgaagcggaagcggggagcggggaggaggccccaggctctggcag
ctgcctgaaactaagtcctcttcagtcaggaatgtagtaggtttaaaggcaggggtgggc
agccgtggcaggtactggcttattgcccatggagggcccaggactggtgctccagtactg
EXON 6  83 bp
ggggagcggggaggaggccccaggctctggcagctgcctgaaactaagtcctcttcagtc
aggaatgtagtaggtttaaaggcaggggtgggcagccgtggcaggtactggcttattgcc
catggagggcccaggactggtgctccagtactgaacccctcacaccctgggtcccgacag
GGGAGCAGACCAAGGCGCTGGTCACCCAACTCACCCTCTTCAACCAGATCCTGGTGGAGC
TGCGGGATGATATACGAGACCAG
gtttgggtgggctggcgaagggtggcactgattctggggtagggtggcagatgtcaagtg
ctgactcctccccatccttctccaggtgaaggaaatgtccctgatccgaaacaccattat
ggagtgtcaggtgtgcggtgagtgggagagcaggggaggctccacatgaccgtgccacgt
EXON 7  52 bp
gggtcccgacaggggagcagaccaaggcgctggtcacccaactcaccctcttcaaccaga
tcctggtggagctgcgggatgatatacgagaccaggtttgggtgggctggcgaagggtgg
cactgattctggggtagggtggcagatgtcaagtgctgactcctccccatccttctccag
GTGAAGGAAATGTCCCTGATCCGAAACACCATTATGGAGTGTCAGGTGTGCG
gtgagtgggagagcaggggaggctccacatgaccgtgccacgttccccacccaatggctt
tggctttcccttctggtggcttaaatagtgaccaccgggtagctctgactgtgtccaccc
ctcaggcttccatgagcagcgttcccactgcagccccaatccctgcttccgaggtgtgga
EXON 8  149 bp
caggtgaaggaaatgtccctgatccgaaacaccattatggagtgtcaggtgtgcggtgag
tgggagagcaggggaggctccacatgaccgtgccacgttccccacccaatggctttggct
ttcccttctggtggcttaaatagtgaccaccgggtagctctgactgtgtccacccctcag
GCTTCCATGAGCAGCGTTCCCACTGCAGCCCCAATCCCTGCTTCCGAGGTGTGGACTGCA
TGGAAGTGTACGAGTACCCAGGCTACCGCTGTGGGCCCTGCCCCCCTGGCCTGCAGGGCA
ACGGCACCCACTGCAGTGACATCAATGAG
gtgagggaggtcagagcccagaagggtacagaaaactggggtgaggatgtcaggaggcac
ccaagagggtgggataaatgctggtccggaggagaggaatctggagtttaggagaggtca
gaggcaagagaaatgcaagatgggagagacagaaggcctggggcaaagactgaaggccat
EXON 9  141 bp
tggcatggggagggagagagggaaccccgagggaagtggggtggggaccaggagcacaag
gcagttgtgtggggagagctgcacaaaggggagacctggagcaatggttcctggatcaca
ggcagggacctgagtttcccagagggcggcctgacctctgccttctcatctggtccccag
TGTGCTCACGCTGACCCCTGTTTCCCGGGCTCCAGCTGCATCAACACCATGCCCGGCTTC
CACTGTGAGGCCTGTCCTCGAGGGTACAAGGGCACACAGGTGTCTGGTGTGGGCATTGAC
TATGCCCGGGCCAGCAAACAG
gtcagactgggtagtgtgtgtggacaagggatcttggccttgtagaggccaggggcttct
gggttggacatgggacccttgtgatgaatgggacatggatggctttgcatcggctttggg
tctgggcttaatgttgatgttcacagataaggccataccagtgtcctctgctgtatctga
EXON 10  78 bp
ggccaggggcttctgggttggacatgggacccttgtgatgaatgggacatggatggcttt
gcatcggctttgggtctgggcttaatgttgatgttcacagataaggccataccagtgtcc
tctgctgtatctgaggagacccaccataggtctggttccacccaaagtctgccccttcag
GTCTGCAATGACATCGATGAATGCAACGATGGCAACAATGGTGGCTGTGACCCAAACTCC
ATCTGCACCAACACTGTG
gtgagctgaatatcctgagtgtattctggggtggtgggaatggtaaaaccccaacccccg
ccccttcttaccttcaaatttcctgctgcctttcctcctccccagggcactacacagatt
aggtgttcacatggacttggtttggaatactggtttgcctcttgctagctctttagcagg
EXON 11  153 bp
cctcatctgaaaactgaggctgttatccaccctgaaaggttgtcatgataacctaaagga
gatactgatatgcctggcataactgagtgcccagcccacactccgcaggtggagcagtgc
tggtcctgggtgcctggtgggctcaccctccttcctaagatgctgcctctccactcttag
GGCTCTTTCAAGTGTGGTCCCTGCCGCCTGGGTTTCCTGGGCAACCAGAGCCAGGGCTGC
CTCCCAGCCCGGACCTGCCACAGCCCAGCCCACAGCCCCTGCCACATCCATGCTCACTGT
CTCTTTGAACGCAATGGTGCAGTGTCCTGCCAG
gtgagctaggcttcaggcgtggaaggaaaagggagggtctggggaaaggagtagggctat
gtttagggcctgggttgggggtcttcataggagagaggtgggcctgggcccaggaactgt
ttggtggggagaataggacctgaagcagggaaaatatagggaggaggggagccagaccaa
EXON 12  111 bp
gagggtctggggaaaggagtagggctatgtttagggcctgggttgggggtcttcatagga
gagaggtgggcctgggcccaggaactgtttggtggggagaataggacctgaagcagggaa
aatatagggaggaggggagccagaccaaactgctagctcctaccctttgtgttgccctag
TGTAACGTGGGCTGGGCTGGGAATGGGAACGTGTGTGGGACTGACACAGACATCGATGGC
TACCCAGACCAAGCACTGCCCTGCATGGACAACAACAAACACTGCAAACAG
gtgcagggagcaggcgggcaagggggcgtagtggggagcccaagctgggtcaggccagaa
ctcatccatcctcttcccctgaactttaggacaactgccttttgacacccaactctgggc
aggaagatgctgataatgatggtgtgggggaccagtgtgatgatgatgctgatggggatg
EXON 13  108 bp
gaatgggaacgtgtgtgggactgacacagacatcgatggctacccagaccaagcactgcc
ctgcatggacaacaacaaacactgcaaacaggtgcagggagcaggcgggcaagggggcgt
agtggggagcccaagctgggtcaggccagaactcatccatcctcttcccctgaactttag
GACAACTGCCTTTTGACACCCAACTCTGGGCAGGAAGATGCTGATAATGATGGTGTGGGG
GACCAGTGTGATGATGATGCTGATGGGGATGGGATCAAGAATGTTGAG
gtgactcccagactgccctgccccttgaagctcctctcccctcctcctgtcctctctgtg
cctcacttacctcatctggcagctctctagtaagggccaaatactccaaatcagggaggc
aaaaacctcgtgcccaggacaaggaggctgggtgggtgggactgtactgagcagtttgtc
EXON 14  160 bp
caaatcagggaggcaaaaacctcgtgcccaggacaaggaggctgggtgggtgggactgta
ctgagcagtttgtccatcacaagggtgtgatcttagaaaaggatacagagacaaggtagg
tgcaagatgacaagtgatttaggggagacctgacccttcccctcccacccctctgcccag
GACAACTGCCGGCTGTTCCCCAACAAAGACCAGCAGAACTCAGATACAGATTCATTTGGT
GATGCCTGTGACAATTGCCCCAACGTTCCCAACAATGACCAGAAGGACACAGATGGCAAT
GGGGAAGGAGATGCCTGTGACAACGACGTGGATGGGGATG
gtgcaggcctggggctgaaggggtggctgggggacctgtgagaatttggatcaggtgggg
atgaagcagggaagctaggaagtctctgtgaaatagggaggcaggcttgtggacgttggc
ctgggtgaggagagattacctgcagcagatgtcaataggaatgtgaggtagggcgtagtg
EXON 15  119 bp
ggaatgtgaggtagggcgtagtgttaggcagagtgtggactagagggtgagacaagaaac
aggcagatttcctggccagttgtcctctgggtggggagacaaagttcgggactttcacca
acctagaagagagaatatggcatgttctagtaacaaccttgtgctacccatgtcttctag
GCATCCCCAATGGATTGGACAATTGCCCTAAAGTCCCCAACCCACTACAGACAGACAGGG
ATGAGGACGGGGTGGGAGATGCTTGCGACAGCTGCCCTGAAATGAGCAATCCTACCCAG
gtacagggagatggtaaggacaggggagggatgagggtactgatggatgaagccccagcc
ctttggatggaaagtggtcagatcaccctcttcagagttatcaagaggagatggtgagaa
caggtccctctctctcagacagatgcagacagcgacctggtgggggatgtctgtgatact
EXON 16  53 bp
gatgcttgcgacagctgccctgaaatgagcaatcctacccaggtacagggagatggtaag
gacaggggagggatgagggtactgatggatgaagccccagccctttggatggaaagtggt
cagatcaccctcttcagagttatcaagaggagatggtgagaacaggtccctctctctcag
ACAGATGCAGACAGCGACCTGGTGGGGGATGTCTGTGATACTAATGAAGACAG
gtaaggtcttggtcaagagacgcaaggtctttcttttttttgtctttctgagacggagtc
ttgctctgtcacctaggctggagtacagtggcacgatcttggctcactgcaacctccgtc
tcccagggtcaagtgattctcatgcctcaacctccctgagtggctaggattacaggcatg
EXON 17  194 bp
agcaggaatttattcttacagtcatccctccattcctactgccagaccttcacctcacct
ggctgactgccaggggtctgattgtatggagagcaggctccagagactcccaggcagaag
cgaagggaaggacaaggagtacctttaaatcctttatttggtacctgttcttctgattag
CGATGGGGATGGGCATCAGGACACCAAGGACAACTGCCCACAGCTGCCAAATAGCTCCCA
GCTGGACTCTGATAACGATGGACTTGGAGATGAGTGTGATGGGGATGATGACAATGATGG
CATCCCAGATTATGTGCCTCCTGGTCCCGATAACTGCCGCCTGGTACCCAATCCCAATCA
GAAGGACTCAGATG
gtaagcctgcggacccagagcacgttagactggtgttgcctttgcccaggtggaggcagc
aagccctgttgggaagtgaggaagggcaaggtggggaaagatgtcaggaatgcaggccca
acagatggtattgttgcctaatggcagtggccagggccttcctgagcacccagcctcact
EXON 18  179 bp
gcggacccagagcacgttagactggtgttgcctttgcccaggtggaggcagcaagccctg
ttgggaagtgaggaagggcaaggtggggaaagatgtcaggaatgcaggcccaacagatgg
tattgttgcctaatggcagtggccagggccttcctgagcacccagcctcactctgcccag
GCAATGGCGTTGGTGATGTGTGTGAGGATGACTTTGACAATGATGCTGTGGTCGACCCCC
TGGATGTGTGTCCTGAAAGTGCAGAGGTAACGCTTACGGATTTTCGGGCCTATCAGACCG
TCGTCCTGGATCCTGAGGGTGATGCTCAGATTGACCCAAACTGGGTTGTGCTCAACCAG
gtaactcggggcagtgggctgggcaggtgctatcagacagggctactgggacggggggcc
tgggagggatagcacacctgcatcacagctttttctttactatacaaccccagggcatgg
aaatcgttcagaccatgaacagtgaccctggcttggcagttggtatgtaagggatatgca
EXON 19  49 bp
tcagaccgtcgtcctggatcctgagggtgatgctcagattgacccaaactgggttgtgct
caaccaggtaactcggggcagtgggctgggcaggtgctatcagacagggctactgggacg
gggggcctgggagggatagcacacctgcatcacagctttttctttactatacaaccccag
GGCATGGAAATCGTTCAGACCATGAACAGTGACCCTGGCTTGGCAGTTG
gtatgtaagggatatgcagttcaatcacttccaaatggaggaatcctataggggcagagg
gtaggggaggaaacagacagggagaatgggcaaagtggcgagagagaaggcagtggcaca
agctggccacatacatagcaggcatcccttcccaactttaccccatgatgggccgccagt
EXON 20  197 bp
gaatcctataggggcagagggtaggggaggaaacagacagggagaatgggcaaagtggcg
agagagaaggcagtggcacaagctggccacatacatagcaggcatcccttcccaacttta
ccccatgatgggccgccagtagctttgctgcccctgacctttatcccacccccaccccag
GATACACGGCCTTCAATGGTGTGGACTTTGAAGGCACCTTCCATGTGAACACAGTGACTG
ATGATGACTACGCAGGCTTTCTCTTCAGTTATCAAGACAGTGGCCGCTTCTACGTAGTCA
TGTGGAAGCAGACCGAGCAGACCTACTGGCAGGCTACACCCTTCCGGGCGGTTGCCCAGC
CCGGGCTGCAGCTCAAG
gtccccagctgctcagattccgcaacccagggccctttcccaaagctctcctctgcagcc
ccagggcctcccccactgcttgactgggaaccctcttacccagacatctggcttggaggc
cggctctctggggccccagggcattttcatgaccgccttgaatccctttcccacctgcac
EXON 21  173 bp
cccccactgcttgactgggaaccctcttacccagacatctggcttggaggccggctctct
ggggccccagggcattttcatgaccgccttgaatccctttcccacctgcacttaccgacc
tgttgtctcccctcactccagttctgcagttgacccactgtctttgccaatgtctcctag
GCAGTGACATCAGTGTCTGGCCCAGGTGAGCACCTCCGAAATGCCCTGTGGCATACTGGC
CACACCCCTGATCAGGTACGACTGCTGTGGACAGACCCACGAAATGTGGGCTGGCGGGAC
AAGACCTCCTATCGCTGGCAGCTTCTGCACCGGCCTCAAGTTGGCTACATTCG
gtaaggagaggggctgagcccacctgtgggactcaggccgggcctgtccttcctctttag
ctgggattcaccagtgacctctccatgggtgggaactgcagccacttctctccatcaccc
ttctcaccacggacacaagcacctatgagtgatgttggtgaagtcactcctccatgaccc
EXON 22  140 bp
aggcctgagaaaagcaccccccttccctctccttcctgcctccctttccctccctccctt
ctctctcaggcctggtgagctcaaggggggctggggaaaagcaaggccccaggcatggtg
gcacagtgcccactggcaccctagcaccaatggatactcctatcctggaatcctggacag
GGTGAAGCTCTATGAGGGACCCCAGCTTGTGGCGGATTCTGGGGTGATCATTGACACATC
CATGCGAGGGGGGCGTCTTGGTGTATTCTGCTTCTCCCAAGAAAACATAATTTGGTCCAA
TCTCCAGTATCGATGCAATG
gtgaggtggctgattgagatcaacctaatccttcatgccttgtgggagagccacatcctc
tgaccttacttatttccccttcttcagacacagtgcctgaggactttgagccattccgga
ggcagctgctccagggaagggtgtgaggaggaggccaccagattcagaattcagaatttt
EXON 23  294 bp
tcattgacacatccatgcgaggggggcgtcttggtgtattctgcttctcccaagaaaaca
taatttggtccaatctccagtatcgatgcaatggtgaggtggctgattgagatcaaccta
atccttcatgccttgtgggagagccacatcctctgaccttacttatttccccttcttcag
ACACAGTGCCTGAGGACTTTGAGCCATTCCGGAGGCAGCTGCTCCAGGGAAGGGTGTGAG
GAGGAGGCCACCAGATTCAGAATTCAGAATTTTAGACCCTTTGGCCTTGGGGTCCATCCT
GGAGACCCTGAGGTCTAAGCTACAGCCCCTCAGCCAACCACAGACCCTTCTCTGGCTCCC
AAAAGGAGTTCAGTCCCAGAGGGGTGGTCACCCCACCCTTCAGGGGATGAGAAGTTTTCA
AGGGGTATTACTCAGGCACTAACCCCAGGAAAGATGACAGCACATTGCCATAAA
gttttggttgttttctaagccagtgcaactgcttattttagggattttccgggatagggt
ggggaagtggaaggaatcggcgagtagaagagaaagcctgggagggtggaagttagggat
ctaggggaagtttggctgatttggggatgcgggtgggggaggtgctggatggagttaagt