Gene TDRKH Variant 1
DNA : 18.96 KbNT_032962
mRNA : 2318 bp NM_006862
CDS : 1821 bp NP_006853
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  143 bp
tattggctgacagggtgggcctgctttggattccatccgggtaattgggcagcggctagc
agcagccacgtcgctcaggggcagcccgcggaaggattggttgtgacgggagaaggcgat
tggtcggactgcgagcagggtgttgattggtgctgtcgggctgcgggggcggggaagtgg
CGGCTGAAGCGCCGCCGGCGGGGCTCACTGTGGTGGTGTGAGTGGGAGGCGGCGGCGCTG
GTGGCTGCAGCTGGGGTGAGGCGCGAGGCGGCGCACTCGACGGCTGACTGGAGCAGCGGT
AAAGGCGAGGATGGAGACCGAAG
gtttggggagtgggaaagacagggtcatgggcagccctggccactaggagacggaaatgc
gggagcgagggaagggaggggtctggcgtgccccggggcgagggaaggatgtggggcgca
gcgggggagtcagagccctgggctgtgagacgccgctcgggggcaacttgacccactggg
EXON 2  151 bp
acttttaaaaaataccctgagccctttttatatgaaataaattttgaaattgctgaagct
cttgaaattggaaggtaggcagtagtagtcttttcagtaataatgtgctcccatgcctct
ctgctattcataaaaggattggatgaaacctccctcttttccctgctttgcttgtttcag
GATATAAGTCAAAGAGTACAGCAGAAAATGTCTACTGAACGGACTTCTTGGACAAGCCTG
TCCACCATTCAGAAAATAGCCCTGGGCCTTGGGATCCCAGCCAGTGCAACAGTTGCCTAT
ATCCTATACCGCAGGTATAGGGAAAGCAGAG
gtacgtgaaccctatgactgtgtgtgtgaaaatgttcagacatgctcctgccttgttaaa
ttgaaaaaaactctttccttgccaggtattgtgtgtgttttgttttggggttttttgtgg
ggtttttttgagacagggtctcactctgtcacctagcctggcgtacagtggcacaatctt
EXON 3  107 bp
gatcctttgggaccttctaattcccattcagatgccacttttccttgttgttatggttga
gatcctcactttatctcttggatcagtgtctctttgacagccagattctggggaggactg
gtagttatactagctttgggtgttatctaagtctgatctgatgaacaatgatctgtgcag
AAGAGCGGCTGACATTTGTTGGGGAAGATGACATTGAGATAGAGATGCGGGTTCCCCAGG
AGGCTGTGAAACTCATCATTGGCCGGCAAGGAGCCAATATTAAACAG
gtaagtgtgtgagtaggcagtctgctttcccaaggattgattctgtttattgatttcttg
tttccttccactgaccccatatcacaaaacattcacatgctctgtgtgtgtgtgtatgtg
tgtgtgtatatataaaatatatatatatatattttttttttttgagatggagtttcgctc
EXON 4  190 bp
ggttgtatagatagtaactgaggttgtatataaagtaattgaggactggttgtatagata
gtattagctaattcctttggctaattctatctacctccagggtttgttttagagtgtctg
tagctgggctcaaatgggagctcttccagaatgtactgccaaatgtccttttctttgcag
CTGCGGAAACAGACAGGTGCTCGGATTGATGTGGACACAGAGGATGTAGGCGATGAGCGA
GTGCTGCTTATCAGTGGTTTTCCTGTTCAGGTGTGCAAGGCCAAAGCAGCAATCCATCAG
ATCCTGACAGAGAATACCCCAGTGTCTGAGCAGCTTTCAGTTCCCCAGAGATCTGTGGGC
AGAATCATAG
gtaccactggatggcttcctctattgtttcctttattctttacctttgcccctctttcac
accttcccagggttttttctggcctagttccccttcaccatgtgaggggaaaaaaaggga
cattgagaccagaggtttactgtttgtagaactggtggtaaaaccaaacctgtttcctca
EXON 5  140 bp
attctccttttcacagtaatgatttcagtagctcctgatttccattcaacatcttgtatt
ttgttcactttagaaatgagaactgattctcttctcctagtatatacaaaacagtgattt
ctccagtagctaaggttggccaggagggaagggcaggtttttatatattgtttaatgtag
GGAGAGGCGGCGAGACAATTCGTTCTATCTGTAAGGCATCTGGAGCCAAAATTACCTGTG
ACAAAGAATCAGAAGGGACATTACTACTATCAAGACTTATAAAAATCTCAGGAACACAGA
AGGAAGTGGCAGCAGCCAAG
gcaagtagctaatagacttgaattatacctgagcatgagaagatccttttactctatccc
aggtcagaatatcatcctttctcttgttttccacagcatttgatactggagaaagtttca
gaagatgaagaacttcggaagagaattgctcattctgcagaaaccagggtcccacgcaaa
EXON 6  322 bp
tgtgacaaagaatcagaagggacattactactatcaagacttataaaaatctcaggaaca
cagaaggaagtggcagcagccaaggcaagtagctaatagacttgaattatacctgagcat
gagaagatccttttactctatcccaggtcagaatatcatcctttctcttgttttccacag
CATTTGATACTGGAGAAAGTTTCAGAAGATGAAGAACTTCGGAAGAGAATTGCTCATTCT
GCAGAAACCAGGGTCCCACGCAAACAGCCAATCAGTGTGAGAAGAGAAGACATGACAGAG
CCAGGTGGAGCTGGAGAGCCAGCATTATGGAAAAACACCAGTTCTAGCATGGAGCCGACT
GCACCCCTGGTGACTCCTCCACCCAAAGGAGGAGGCGACATGGCTGTGGTAGTGTCAAAG
GAAGGTTCCTGGGAGAAACCTAGTGATGACAGCTTTCAGAAGTCTGAAGCCCAGGCCATC
CCAGAGATGCCCATGTTTGAAA
gtatgtaacaaagagggagcccattaatcattgaagatagaaatactggcttagatattg
gagagattagaaggaatgccttctcagtctgagcagccagtataatatggctggggtcag
gacagaagattcggtaagatattttgaagatgggatggaggtagaatccacaccaacagt
EXON 7  161 bp
acaaaggatagcttagtatctttctttaggatattcttgtttgattcatccagttgcctc
tcctgccattttaaaatggtaacagccattggtatttgtacctctcactaccctggttag
tctcttcattccaaccagagatgggtctgatgtggccaccatccttatctctgtgttcag
TCCCCAGTCCTGACTTCAGTTTTCATGCTGATGAGTACCTAGAAGTCTACGTTTCTGCTT
CTGAGCACCCTAACCACTTCTGGATCCAGATCGTTGGCTCCCGCAGCCTGCAATTGGATA
AGCTTGTCAATGAGATGACCCAGCACTATGAGAATAGTGTG
gtgagttgccatagggacagggctggggtttaatgaaaagaaggcatatctttttcattg
tactcttcctttccctgtggagcaactacttttctttcttcctcctgcaattctgtttat
gagcctaccactttgtaactctctgcctttctcctcctccccacatacagcctgaagact
EXON 8  173 bp
gaatagtgtggtgagttgccatagggacagggctggggtttaatgaaaagaaggcatatc
tttttcattgtactcttcctttccctgtggagcaactacttttctttcttcctcctgcaa
ttctgtttatgagcctaccactttgtaactctctgcctttctcctcctccccacatacag
CCTGAAGACTTGACTGTGCATGTAGGAGACATTGTAGCAGCACCTTTACCTACAAATGGT
TCCTGGTATCGAGCCCGGGTCCTCGGCACCTTGGAGAATGGGAACTTGGACCTCTATTTT
GTTGACTTTGGAGATAATGGAGATTGCCCACTGAAGGACCTCAGGGCTCTCAG
gtcagtgctgaggtcagctcaatcccaactgctgactcagttctggccatagggtggtga
gctgttggcagttgtcagggggatttggaagggaacctgtttacagagagcagatggtta
tcgtctcatgttagttggttctttctgaaagcagcaatgtaagaagatgtttttggcccc
EXON 9  65 bp
ctgactcagttctggccatagggtggtgagctgttggcagttgtcagggggatttggaag
ggaacctgtttacagagagcagatggttatcgtctcatgttagttggttctttctgaaag
cagcaatgtaagaagatgtttttggccccaggattctaattttagtttcttttacttcag
GAGTGACTTCCTAAGCCTTCCATTTCAAGCAATAGAATGTAGTCTGGCACGGATTGCTCC
CTCAG
gtaaattggtcatgccatctattgagcttacctccaaatagaataacttcatacagttca
ttggaaggaattctcacattcccaggctttttgaattctggggactcaggtgccttttcc
tcaccagcactagcagcagccagaaacttgcctggcagacccaacccaaccagagaagac
EXON 10  152 bp
tctggggactcaggtgccttttcctcaccagcactagcagcagccagaaacttgcctggc
agacccaacccaaccagagaagacacaggtgccttcctgagtagaaaagggtagttccaa
cttccctccagggtataagccccacccctatcagcagtaacccctacaatcttttgccag
GTGACCAGTGGGAAGAGGAAGCTTTGGATGAGTTTGATAGACTCACTCATTGTGCTGACT
GGAAGCCTCTGGTAGCCAAGATCTCTAGCTATGTCCAGACTGGGATCTCAACTTGGCCAA
AGATCTACTTATATGATACTAGCAATGGGAAG
gtaagactggcattcactcactgcttgccatatcttcagtatatttatagcctaatttac
tttttcttcctcagaaacccttatctgatattactcttactgtaagatccttctcaccat
ctcaccaaaggaatgtctttaaagtatcagtccttctgccttgtttcctcaaatttgccc
EXON 11  102 bp
tatagcctaatttactttttcttcctcagaaacccttatctgatattactcttactgtaa
gatccttctcaccatctcaccaaaggaatgtctttaaagtatcagtccttctgccttgtt
tcctcaaatttgcccttgcttactgagagaacatcattcccttttcatttttcttctcag
AAACTTGATATTGGGCTAGAATTAGTACACAAAGGATACGCAATTGAGCTTCCTGAAGAC
ATAGAAGAAAACAGAGCTGTCCCAGACATGTTGAAGGACATG
gtgagctattgtagttatatagggtgctgcttccaggcaaatctagcacatagacactaa
gggcttctagtcctgatactgtgttagctttcctaaggactttgagctcctccagtagtt
gaccaaaggagcattttgtccctcttggtagccaaatgcaactgccttaaccaggtccta
EXON 12  97 bp
ctgtgttagctttcctaaggactttgagctcctccagtagttgaccaaaggagcattttg
tccctcttggtagccaaatgcaactgccttaaccaggtcctatgagaagaatgaaagggt
ggcctcttttttcctaaaagccaacatgttcctccttttttcctgttttcatccactcag
GCCACAGAAACAGATGCCTCTCTCAGCACGTTGCTCACTGAGACCAAAAAGAGCTCTGGA
GAGATAACACATACCCTGTCCTGCCTCAGCTTATCAG
gtacaagcagtatttcctccctagagcatctttggagattaacttttctcattcagtctt
tccagagtagggaggttaattgaaggcttggttcctagtcaggtcattgagtaccaagag
gtccatttttcttttgagcctcgctggcattgcctgctagaatagggcagtgtctaactt
EXON 13  92 bp
gcatctttggagattaacttttctcattcagtctttccagagtagggaggttaattgaag
gcttggttcctagtcaggtcattgagtaccaagaggtccatttttcttttgagcctcgct
ggcattgcctgctagaatagggcagtgtctaactttctccttcttatttatcttcaatag
AAGCTGCTTCCATGTCTGGTGATGATAACCTTGAAGATGACTACTTACTCTGAAGTCTGG
GCTTCAGTTTGCTCAGCCATCTGCTTTGCTGT
gtgagtgcagctatcatctatctgtagcaacaggaaagtaatgagggcgacagtggggca
cttgctttgattccctctttcccatgccctgtcttaatatacttctctgcagctgctttc
ctgcagcttaacttgctctcagattgagcactttcaagctttttgtgtatttctgtcttt
EXON 14  423 bp
ccaagattgcaccactccactccagcctgtgtgacacagcaagatgctgtctccaaaaaa
agaaaagaaaaatctcagtcccaattagcagaaaggctctagtgaaggaacagttctggt
gagtagttcaggtactcttggaggaatctttaaggagcttccatttatttgatgtttcag
ATGTTGCCTGCAATGAACTCGCTGAAGCATGCTCAGCCCTGGAACTGGTGCTACCAGAGT
TCCGTAGGGAACCTTTACTCTTTAGAGGTTCCCTGATATAAATCATTCATAAGACTTCCT
ACCCTGGAAAATGAGTAATGTCTCATTCTTACCTGCAGTTTGTTACTATGTATAAAAGTC
TTTTTCTTTAATATGCCTTTAAGTCTTACCTGTTTACAGCCCATTCTGATGGGTTCTTTG
TCATTCTGTTAGTATAACCCAGTACTTTTCCTGCTGCCTGGAATGCCCTCTTCTATGTTA
CCTATTCTGTCCGTTGAGATCCCCCAACTTGGGCCAAAGCCAAGAGATCTATGTGCCTTC
TCTGGTTTTCTCCACATCTATAGCACCTCAACTGAAATATATGGATAAAAACAGCCTAAC
AAA
gctcagtctttctgaactaggaagttcactgattagtgctcagtaaatggttagaataaa
tggggaaatagtttggggcatggaggaaggcaaagggaaccaaaaatccttaggtacttt
cctccgtagttcaggtccctgtgatcttttcagtgaatttagctctgttaaggtgtatat