Gene STX12 Variant 1
DNA : 51.03 KbNT_037485
mRNA : 2842 bp NM_177424
CDS : 831 bp NP_803173
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  153 bp
ccagtcccagctccagtcccagcggcgcctgcgcactttggaccggggcggggaggacgc
gtgcgcgccgcgtgagggcggggctagtgcgcacgcagccttagctccttccccgccctt
gctcttcccagtttctccgtcagcctgcgggtcccggctggcggctgcttccggtaggag
AGCGGTGTAGAGCGAGCAGGTCTCAGCTCCTCGTCATGTCATACGGTCCCTTAGACATGT
ACCGGAACCCGGGGCCCTCGGGGCCCCAGCTCCGGGACTTCAGCAGCATCATCCAGACGT
GCAGCGGCAACATCCAGCGGATCAGCCAAGCCA
gtgagccggggtaccgagctggggggcgggagctgtcccggggacaggcctgggtgaggc
tgccgggacgcagggcccggctggggctacggccgaggccacacctggggctgtctcggg
ctgtccaccctgggggcggtgggctgccatcccccaatctgtcaggcccgggttgcccga
EXON 2  70 bp
accttgtaattagtttttggaggaatgtgtgtgtcaaggttttgatcatagcatggtctc
tattagttgcatgtattaatacttattctgaatgggaagagaccaggaatcttagaagta
gggtactcatgatgaatgtatttttcttttaaataaatctttttcttcctatctccccag
CTGCTCAGATAAAGAATTTGATGAGCCAGCTAGGAACTAAGCAGGACTCAAGCAAGCTAC
AGGAAAATCT
gtgagtaacttcctgacaaggttgggttttgtgagggccatttgaggacacagtgtcctt
gccagacagcagcttaggtttcaggtctgggaagtcagaatgagaggcagtgggtcatga
gataagagctggatctaaaagaggggcggggcaacaaagtatattaatggattgtaattt
EXON 3  100 bp
gaagtgggtttgcctgggtaatatttctggaattttgttgtgaacctgggcatctaggga
ctcatttcttcaaatggcccttcattccctacgttatgagacactctgagaacaaagtgg
ttctgtgtataaccctctcaagaagtgacaacatcctgaaacatatcttttctctcttag
GCAACAGTTACAACACTCCACAAATCAGCTCGCCAAGGAAACAAATGAATTGCTGAAAGA
ATTAGGGTCCTTGCCCCTTCCCTTATCTACTTCAGAACAG
gttggtattttctgttttgtttattaataggaaaggactttgtgttagtagaaaggcagt
gtgtagaacaaaaaaaaaataagttggcctttggtgctagatagatagacctcctctgca
cctcagtttcttatccatcaagtgggggatatgtgactgttggggcaatagaaagaatgt
EXON 4  138 bp
agtattaaccagggacttgagctagcaaagagcaaatttattaatttaaagaagagacta
tttcataataattttcctagttggaaatctttaaggggtataattttacttttaagggaa
attaaaaccaaatgattctgggttaatatgaaatctcaagttcttgcttgatttccttag
CGCCAGCAGAGACTTCAGAAGGAACGCCTCATGAATGACTTCTCTGCAGCCTTAAACAAT
TTCCAGGCTGTGCAGAGAAGGGTATCTGAAAAGGAAAAGGAGAGTATTGCCAGAGCAAGA
GCTGGATCTCGTCTTTCT
gtaagttgattcccaaaagaagacctttgcaatatcagaatgttcttttccaagtttgtg
ggtttttttctttttctctttgaccaataaacatgtaagttagctgctgtgaaaatggca
ggttggtgtaacctatgtaaaaaacatatatgcatgtgatcaaagcctagaaaggaatct
EXON 5  44 bp
cttcaaccactttacacccacttcttagttgagacagattgccagagtcctatgtaatct
tacagattctgtgggtgtcaaaggatgttgcttctttatactgtgctaaggaagcccttg
ttttgtgtgtctgtgatgtgtttctggatgacagcagcaataataccatctactttctag
GCAGAAGAGAGGCAAAGAGAGGAGCAGCTGGTCTCATTTGACAG
gtaatagaattattcatacaacctgctggatagttgagatgggaatctatctcgttatat
tttaattttaaaaatcaatgaaaaaatagagggcaaaaataagggggcacctggagtgga
taacataatccacagaataaaattaaaaaggcaaaaccatgggcttttccaagctctttg
EXON 6  106 bp
tatcatcagctctttgcttctggatatgaagaatgtggccctccaagactttattgatag
cagaggactggagccctggtaatgtctttgcataggttctgctggcagtagagatgttgg
agatatgtcttgttatgcctttgagaggagaaatcacctagtgtgcctgtttccctgcag
CCATGAGGAGTGGAACCAGATGCAGAGCCAGGAGGATGAGGTGGCCATCACTGAGCAGGA
TTTGGAACTTATTAAAGAAAGAGAAACGGCAATTCGGCAGCTGGAG
gtgagagccacgtcatgttttttgtttgactcagtgtgtctgcaggtatctgaactcctt
agttcactttaattctcttagtgattatgaaaaggcataaaatgtgtcattgtgtgattt
gtattttttctgtctcagtgtaatcatggtgggtttgaactaccggttttttttgttttt
EXON 7  73 bp
gtgccttctgttttacaatattgggtaggcagcaatagattattttctgtttatggagaa
agcatgctttgtagagccttaaaaacacacgtgttaatagctaaaactttaggtacgtga
gggaaacaaatcttctaacatgttgcttaatgttagttaattgttttttgtcttccttag
GCTGACATTTTGGATGTCAATCAGATATTTAAAGATTTGGCCATGATGATCCATGACCAG
GGTGATCTGATTG
gtatgtattattgatacctttaacctcaaggtgagttgatagtatttggcatgcatctgt
aatcccagctactcagaaggctgaggctgaagcaccatctaggagtttgaagccaacctg
ggcaacataatgagaatttgtctcttaaaaaagaaagaaagaaagaaaaaggagttaggc
EXON 8  83 bp
attcattgttttttctccaaagaaaaggctagtctcttaccaaggtagtaactcgatttc
atggctggatagtttggatagtggtagtgaaaccaggacatgtaacatcagaaatctgtt
caatttgcagtcttaaaacatctgagtgtgttaaaacatcctctgtccttccttttgcag
ATAGCATAGAAGCCAATGTGGAAAGCTCAGAGGTGCACGTCGAAAGAGCCACTGAACAGT
TACAGCGAGCTGCTTACTATCAG
gtaaaagcgggtaccaaagaaagtcactctgtgttgcagactttttaggccatcagagta
cattgacatattgagaacagctacagcctttgcttaggtttaagctaaaggaaagtagtc
ataattgcagtcccagttccatttttattattttcctttgcagatagatctacaaaaaat
EXON 9  2075 bp
acttgcactactacctagtgctgctgacttaagatttctgggaaagtctgtgcataattt
tgcatggatagagttaatctttaattacaaggaggcagatttatgaagcattcttagagt
cttacacatacaaattttacttgtttcatgagtatcttgtttacatatttctttcctcag
AAAAAATCTCGCAAGAAGATGTGTATCCTGGTGCTTGTCCTGTCAGTGATTATTCTAATC
TTGGGACTTATTATCTGGCTAGTTTATAAAACGAAGTGATTGCCTCCGATCGTTCTCCCG
CTGAGCTGTTTTCAAGGGCAAGTGCTTGTTGAAGTCTTGCCAGAACAAACTGATCACAAG
AAGACAGCATATATCAGAACGTCCTGTAATCATTTAGTTAGAAACTAACTACTAACTAGT
CTTTGGAATTCGTGACCTATGGAGACAGTAATTATCAATTTATTGATTCTATTGATTTCT
CAAATTAGGAATTAACTTATGTGGATTTTGCTTCCTCTTGTATTCTGATTGCCCTTCATC
CCAAGTGTTTACTGAAAATTCCATTCTAGATATTCTTGTTTTGACAAATGACACTACAGT
CTCGTAATATTGTCTTTTATGTATATACAAAATTTACCTTTTTACTAGCATCTGAGATAG
AGTTACTTTCTGGTACCCAGTATATTGGAGTCTGTCAGAAACTCTATAATAGGCCACCAG
TTTTTATTATTTAACATTTTTATTTGAATTTCTAAGAAGCCTATTCTCTATCTATTTTGA
AAGATTTTGGCACTATATTTAATTGGAAGGTAAAATATTGTACATGTGATCCAGAGTAAA
TGAGAAGTCTCTATCTGAGCTGGTCAGTTACTGGAGTACATGTTACTAATCTGGGTTTAA
AGTTTACTTCATTATCTGCTAGTGTCATCCACAGCAGTTCATCCTCATCCACACTAAGCC
ATCCTGTTAGCTTTTAAAGGAAGTTAATTTAATTAACATTAATATACTCTATGGGCTCCC
TCTCCCACCTGTCTGCATAGAAAGGCAGAATTAGACATAGCATGCTTTGGAAAAGCAAAT
AGGAATTGTTGGGAATGATTTAATCTTGTTGTTGTTGTTGTTGTTGTTCACTTGTGGTTC
TACATTCCTGGTGAATGATGAATGTTGCTGTCAAAGGGCTGCCCCCTACCTTATAAGGGT
TGCTGGGCATTTGAAGGCAGGAAGATTTTTAAAGATAGATTGAGGTTGGTTTAAAATTAT
TCCTGTAAACCAACAATAAAGCAAAGAAGAGGTTCATTTTTGTAAATAACACTGGTTTCA
AATAGTGATGTTAGACTTAACCTAATTTATAAACAAGAGATTAATATCTCCATGCATAGT
TTTAGACAAAAAAAGATGTTTCAATAAAATTACTGTCTTGTAATATAAATGTTGTCCACT
TCCCTTTTCCACAGGCCTAGAACAGTTAAAGGGAACATAATTTGTTTAGGCTCCCACATA
AATGTGAATCTGGCCAACAACTTTGGTTCATCCTTTAGTGAATTAGAGGATTTGGCTACC
CTGAGTATATTTATATTCATTTCTTCTGTTCTCCTTCTGTTATTATACTTAATCTTCTAA
ACTAAACTAATGTGAACAGTAGGGAAGCAAGGGCCCAAATGCATAAGTTTCTTTGCACTG
TTGCACTTACTTAATACAAATAAATGTTTTTTAAAGCTTTTGTAGTATGTTTTTATGAGT
TAACATCCTAATGTGGTAGGTATTAGGTAATGTGCTGTCATGAGAAAAATTGAGACTTCC
AAGAAAACTGGACACCAGGTGAGGGTTGGTTTGGAGACGGAATAGGTGTAGCTGCCTTTC
CTTGAAAAACAGTGTGTAGAGATGGCTGAGTGCAATGGCTCACACTTGTAATCCCAACAC
TTTGGAAGGCTGAGGCGGGAGGATCAGTATATCGGTACGTCTGAGCCCAAGAGTTCAAGA
TCAGCCTGGGCAGTATAGCAAGACCCCATCTCCATTTTTTTTTTAATGATTTTTTAATTA
AAAAAAAGAACAACAGGATAGAGCTGTTGGGGTGGCACAGTGGCCCAAAGAGCAGCTTCA
GAGATAATTCCTTGGTTCTATGATCCCTGTTTAACTCCAAATTACAGTCGGACTTGGATA
CATCATTTGTAACATTGTAGGAAAGAAAAAAGTCTTGGTTGTGAAAAACGATTTGCATTT
GGGTAAAATAAAGTGACCATGCTTTTGTTCTGTAA
tactgtgtgacctgtggttgttgtaatggtgatcatggagagcaaatatgaacttggcct
ggattttaaatggcctagaatttgtggtagttgccaaagaggttctcctaggtggtctta
ataaacctattcacagaattctccttatctgtgccttgattatcattgggagcatcacaa