Gene SSR2 Variant 1
DNA : 11.89 KbNT_079484
mRNA : 1092 bp NM_003145
CDS : 552 bp NP_003136
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  49 bp
gggccgaataagaagcctggagaacgcacaaacctcttaggagcgctcacagcctctcag
gcaggcgggcactacaaagggaaaggtggggcttctccaagaactacaactcccacaagg
cattgggcggaacaccacggtttccggccagtgcttatttccggtctttcggatgctgac
GCTCTCTTCCTGTCTTTGTGGCTCCGGAAAGGCGTTTGGGATGCCAACG
gtaagtccggaggcttagggcgtccgaacgggagaggcgagagcctcgtgtccgcgcatc
accccgtggctgggggttagctaggggagggcgggaagggcagaggacgcggtggctgga
ggacgtgtaaccttgcaagaggcgggaggcggggggcagaggtgattgacccccgccccc
EXON 2  155 bp
gggtgaagatggtaggagagtctggagaacgggtctgctctggtggcttatggactactc
tgtggaaggggctgctgttctggtagcatcgaaggagctttctacgggagcgctgtcaag
aggattttggtgaatttgacgtacttggtttgataactcactttgcttttttctctaaag
ATGAGGCTGCTGTCATTTGTGGTGTTGGCTCTATTTGCTGTCACTCAAGCAGAGGAAGGA
GCCAGGCTTTTGGCTTCCAAATCACTGCTGAACAGATACGCCGTGGAGGGACGAGACCTG
ACCTTGCAGTACAACATCTACAATGTTGGCTCAAG
gtaactcgaggccctagagttacagattaagcctatttctggattcttagttttcagatg
ggaatagggagcatattggtgggtagtggtttctctttgggacacttccagcatcagata
tattgagtgaatgaatacacttcgggatctacttttggaaaggaggacattcttacctaa
EXON 3  99 bp
tttagtagagacagggtttcaccatgttggccaggctggtctcgaactcctgacctcagg
tgatctgcccacctcggcctcccaaaagtgctgggattacaggcgtgagccacggcgccc
ggcctgctttaattttatatccattacttactaaccctttttgtttcatccattttctag
TGCTGCATTAGACGTGGAACTATCTGATGATTCCTTCCCTCCAGAAGACTTTGGCATTGT
GTCTGGAATGCTCAATGTCAAATGGGACCGGATTGCCCC
gtatcctcttggcacttggtgatgaagggtcggggggcagggagagccttgcctgcaaag
cagcaggggtacttcaaataggctggatatgtgtggctgtcctcctgtcatctctctgga
taagatggagcaagagaggttggtgtaaattgtgtgagcatgatttagagtagacatgaa
EXON 4  109 bp
acaggcgtgagccaccatgcccggcaaagaagcctatattttttcattcctgcagaatat
tgccggcatgagatcagcatgtattggcaaatgttttgtaagtggtgcatttagtccaca
ggttgaaaggctgctacaactttagcttcatctctttccgttccttaactcttgagccag
TGCTAGCAATGTCTCCCACACTGTGGTCCTGCGCCCTCTCAAGGCTGGTTATTTCAACTT
CACCTCGGCAACAATTACTTACCTGGCCCAGGAGGATGGGCCCGTTGTG
gtgagttgcccaaacccttagctggatggaatttggatctgccttcccttaaaatctctt
gtggtgggggtaagagggggatgaagagaggttgattaatagataccaaaatacagttag
gactgggcgcagtggctcacacctgtaatctagcatttttggaggccgaggtgggcagat
EXON 5  78 bp
atcatccaactctctctagccaaaagctttccctcatcttcttgaagttcttctgagcct
ttgggaactaagactctaatgcatagagttgggttggttgggactgccctttctcagagt
agatgaggtggaacttcatgaggtggacttcccttaatgtcgttcttttcttcttttcag
ATTGGCTCTACCAGTGCACCTGGACAGGGAGGAATCCTGGCTCAGCGGGAGTTTGACAGG
CGATTCTCCCCTCATTTT
gtaagctttctagtgttctctctcatcagttccttggtatgagaatgcccttttggttct
ggaccctcttggcttccacagatttgttttgttggttggttcttgccctgtgtgtttttt
ggtgtctgatatagatactcatcaaatagattgatttagccatgtccagagatttttggc
EXON 6  602 bp
ctgcataccagcctaggtgacagggcgagactccgtctcaaaaaaaaaaactaagacttt
gtatcaaaaataaataaatttgggctagactgctccctttctcattggactcatattttc
cctggcttctcctgtgccctaatccagacttctaagcaaggtctttgttttcctttacag
CTGGACTGGGCAGCCTTTGGGGTCATGACCCTTCCCTCCATCGGCATCCCCCTGCTATTG
TGGTACTCCAGCAAGAGGAAATATGACACTCCCAAAACGAAGAAGAACTGATTGGGGCTT
CCACAGCCCTCCTCTCCCAAGAAATCCAGGCTCCTCTCCCAAGAAATCCAGGTGCTTTCC
AGACTCCAAAGGGTATCTTAAATGCAATCTCTTCTCTCTTAGCCCTTGGCCACTTTCTCC
TGGATCCTGCCCTGCTCTCAGCCATAGTGAAGGACCAGCCCTAGGAGTCTGCGAGAGCCT
CCTTGGTTCCATCGTGAAGCCATAAACAGGAATGCCTTTGGCAATAGCCTTGAGCCTAGA
GGGCCCTCTGATGCCCCACTGAGGTGCTGTTGGTTTATTGCTGGCAACGTGAATTCTCTC
AGGGGTCTAGGAGGGGCATTTTGGAGACTGCCTGACACCACCCCTATCCCCTGCCTCCCC
CTCTCAGAAGAGGGTGGAAGATGAAATGAAAGCTATGGGACTCTTGGAGGATACCCAGTG
TCTATTCTGGGTTAGAGAAGTGCTTACTAAGGGGTTTTCTAATAAAAACAAATGCCACAT
TG
acttgtctgttttcttagcccccgggtgaacacaggtgattattggaactcagtctttgc
ccagacccctgggcaagcgagctgggttctggccttgctgcaggggttgtgggcgggtcc
tgttcccatggagatatctgcccttttgaatcttttgcttccatcccttattttcctctg