Gene SORT1 Variant 1
DNA : 84.15 KbNT_019273
mRNA : 2797 bp NM_002959
CDS : 2496 bp NP_002950
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  365 bp
ttccagccaatcagtcccgcatcttagcatccgaatccaggacccccgaagccggaggcg
acgcgagccaatgaggagtgggccggggaagagggacaggcggccagcctatggggcgga
gaggcccggccgcgcgtatccaaggagcgccgcgctcggctcgggggtgtggcgcgcgcc
GGCGGGGGTGGGCGGGCGCGCCGGGCGGCAGGTGTCGGCGTCGGCGGCATTCGGCGGCGA
TGGAGCGGCCCTGGGGAGCTGCGGACGGCCTCTCGCGCTGGCCCCATGGCCTCGGCCTCC
TCCTCCTCCTGCAGCTGCTGCCGCCGTCGACCCTCAGCCAGGACCGGCTGGACGCGCCGC
CGCCGCCCGCTGCGCCGCTGCCGCGCTGGTCTGGCCCCATCGGGGTGAGCTGGGGGCTGC
GGGCGGCCGCAGCCGGGGGCGCGTTTCCCCGCGGCGGCCGTTGGCGTCGCAGCGCGCCGG
GCGAGGACGAGGAGTGCGGCCGGGTCCGGGACTTCGTCGCCAAGCTGGCCAACAACACGC
ACCAG
gtgagcgggcgccgggcccgggagccgctcgggtgcgaggtgccgcccgcgtgcccctcc
cggcccgtgcgccccgcgactcccggaggagaccccagccctgccgcgcccgcgtccccc
gggccgcagccccgaaactgcggcgggcgggcgggcggagtcgggcccgggcggccggcg
EXON 2  60 bp
tgtgattcacattaagtagttaaatcccatccctcccaaattttgtactgggaatccata
cccactttgtaattatgaacttaattactctgaacagtaataaagttcagatatttaaag
aagccaaagattgaaggagagtggctgtcatttctaaattaattttttttccccttatag
CATGTGTTTGATGATCTCAGAGGCTCAGTATCCTTGTCCTGGGTTGGAGATAGCACTGGG

gtaagtcatattttgagtctgttatttcagcccagcaagaagatgataacagatttgggg
aagggttaagcacctaatatcatttcttcctgaaactgtctttagcctcaatcacagaaa
acacatgtttgcaagacagactttcaggaagttgtagttgtgttggttttgctttagaat
EXON 3  74 bp
aaatgagctgaggactttctcatcattctcagccctagtaactagatccttctagacttt
ggggagtactacaaagtagggatatcaaaagtcttttaggtgttggcttaatctcgaaca
catatcagcatgtgattggaatatcttttttatttacggaatgcttttttctctctccag
GTCATTCTAGTCTTGACTACCTTCCATGTACCACTGGTAATTATGACTTTTGGACAGTCC
AAGCTATATCGAAG
gtgagatcaataacacgcgttggagcatttcactaagtaacattgagaatatagattctc
ccttttctagacatgatggcacgtaacagttgatgtaaaagatcttctagccatcctaag
ttttcaccagactgtcacactcagcacatgtttttgttgttgttgttgttgttgtttttt
EXON 4  103 bp
ggggcgggtggaatgttcttcggactcaccagggcacctctggagctaggaatgtggcta
ttcagggtgagccgagtctctcagcatgattggtggaaagggagaatgaaagctgagtag
gaactcagtaatatccatgaccactgcaccctaaatttgccctttttttcttcctctcag
TGAGGATTATGGGAAGAACTTTAAGGATATTACAGATCTCATCAATAACACCTTTATTCG
GACTGAATTTGGCATGGCTATTGGTCCTGAGAACTCTGGAAAG
gtgagactcattcttgtatacataaagcttgtgcttgataccacatgcagagctgtcaga
tattagtattggcatggtccagtgattcacagtaatgtattttagtttagtattgctata
tttatattttaaaattaaacacaattttttaagggtctcactctgtctcccaggctggag
EXON 5  165 bp
ttatttttttataagaataagacccaaggggtagagtggaacaactaatcagtttttata
actcttcttatttctagaactaaaatttcttaactaatgtctggtgaaaatggtgtaaga
actcctgtgcttgcatagatagtatcataccctgaatcagatctttcctcttcctatcag
GTGGTGTTAACAGCAGAGGTGTCTGGAGGAAGTCGTGGAGGAAGAATCTTTAGATCATCA
GATTTTGCGAAGAATTTTGTGCAAACAGATCTCCCTTTTCATCCTCTCACTCAGATGATG
TATAGCCCTCAGAATTCTGATTATCTTTTAGCTCTCAGCACTGAA
gtaagtccagttgaggaacatggtttgccttttgcattttatagtctcaaatgtactgtc
ttagaaggatcctttaggaaatgcttttaatattggacttctttcaagtctccttatggc
atgaagtatgtatttttttgacgttttttcctatttggtaaaggacacgatttccacatg
EXON 6  74 bp
ccaagaccccaaaagggcccagataaactacgtgtgtgtctgtggagctcgggcagctct
gatggagcttcagtatgtgtttttcctgtcctgaatgattggatatgaaatattaaaggt
catacaagcaactacacaggataaagctagaattttgataagtcatttataatctttcag
AATGGCCTGTGGGTGTCCAAGAATTTTGGGGGAAAATGGGAAGAAATCCACAAAGCAGTA
TGTTTGGCCAAATG
gtgagtaacagaagactccatctgtgcagagccctaaacccttcctgatagcgctgccaa
aaatcacatgaataaatattgagcacttactgtgtgccaagtactcttcagggtgccata
agagatattggagaggggtgtgacacaggccttgacctggaggagcttctcattctgctg
EXON 7  50 bp
ggcagtggggagcttgacaggcagagctgtgaaggaccagggctcagcgcctgagaagtg
gtgcttgtcagtgcctgtgaatgaagcttgttagacctgctaggaagtttgtgagtaagg
tcaacacagtccttcagcagtcttaaaccatttcttttccctgtttttgcctcattgtag
GGGATCAGACAACACCATCTTCTTTACAACCTATGCAAATGGCTCCTGCA
gtaagtatattttagtcccagaaaataatgtcctgttgtccattcatggtagaattttct
gggttgtgcaaggtagaaacataaaaggtccctccattctcctgaaattgtaatagctaa
agaaagctgttagtggttattaaaatcttgaaagtaaaaccaaattactacactacccag
EXON 8  131 bp
gggattacaggcatgagccactgcgcctggccgctgtatcacattttatgttgtcacttg
attaacatgcatagtatttaaaatgctttagctataaaattaagattgattctaaaacaa
ctgctttgaactaggctcaccagtaagtgaaattttaattaatattttgtcttgtttaag
AAGCTGACCTTGGGGCTCTGGAATTATGGAGAACTTCAGACTTGGGAAAAAGCTTCAAAA
CTATTGGTGTGAAAATCTACTCATTTGGTCTTGGGGGACGTTTCCTTTTTGCCTCTGTGA
TGGCTGATAAG
gtaggtattgccctctcccctttggggtctgatatttctgcaaatatctctcgtatagat
tctctttattacttggcattgacagagtttcttgtctttttgttatatttagtaccactg
tgagtgttaggggtgattctttttgcaaaggctgattgactgataggctactctgcactt
EXON 9  145 bp
ctagaactttgctaggggctagaaattgctttggtaattggtactatgacctttcattca
tagcaatcgtacccagtagagaaatggataatagtagttatttaaaacattcttgttcat
gtccctgcccatggcatcttggcagaaaattagaaagataaatattgacatctgttctag
GATACAACAAGAAGGATCCACGTTTCAACAGATCAAGGGGACACATGGAGCATGGCCCAG
CTCCCCTCCGTGGGACAGGAACAGTTCTATTCTATTCTGGCAGCAAATGATGACATGGTA
TTCATGCATGTAGATGAACCTGGAG
gtaagagctttttagtggcttacccttaaaagcatagagatgtaagctttgagcagcttt
tatttttacatgtcgagttttcctcttacccctagaaatttattagtgccctactgattt
ttctgtcctagagatcatctgtagcccctgttaaaaatgccacttgttttggtagcttgt
EXON 10  156 bp
gatgggcataaagatcttgagtatcaaaccttgattaattctcaggtctgagtcttcatc
atgaagagacacaattggctactgtgtttggtcaggcaggtaatcgtgtgtggttagact
attgtttttctctttggttccacccaagacttagtatttttgtttgtttgcctatttcag
ACACTGGGTTTGGCACAATCTTTACCTCAGATGATCGAGGCATTGTCTATTCCAAGTCTT
TGGACCGACATCTCTACACTACCACAGGCGGAGAGACGGACTTTACCAACGTGACCTCCC
TCCGCGGCGTCTACATAACAAGCGTGCTCTCCGAAG
gtgagtctcggcatcgcagtggtgtactgtgccttcagctgcatgtggtaggatttgagg
cttcggggaacctgtcccctagtaatgttgcttgccaagccaacaagcctacccatgtac
atttttttgtttccttttttttttttattgtggcaatatgtctaacaaaatttgcagttt
EXON 11  107 bp
ctcaaatatcatatttaaagtgctgctccgttaccaacaatgagccgttttgtgaggtgt
tacaagcttgtcggactccaggtgctatacggtctcaggagagagtcatgcagtgataaa
gtgaatctaacctaggtacttccagtgtatcagacttaatgttgttctcttcccattcag
ATAATTCTATCCAGACCATGATCACTTTTGACCAAGGAGGAAGGTGGACGCACCTGAGGA
AGCCTGAAAACAGTGAATGTGATGCTACAGCAAAAAACAAGAATGAG
gtttgtttactctaatgtgtgcagagcacagcagcctttccattgtgctctgatcagtgc
cagccttttggatgatgaagtttcatacttgattagggtcctcagcataaggtggaaagt
ttggagatgagagtaatgaaattaacttagaatttcggaagtaagaactgaggaaaggtc
EXON 12  103 bp
caatgtgaatatacttaacactactgaactatacacctaaatagtaaataaatagttaag
atagtacttttacctaggtctgggttaacttaaagctttattggaagggttttgtgaaat
gattaaagaaattgtatctttatctttggttctaatctacgcttttgtttcttttcacag
TGCAGCCTTCATATTCATGCTTCCTACAGCATCTCCCAGAAACTGAATGTTCCAATGGCC
CCACTCTCAGAGCCGAATGCCGTAGGCATTGTCATTGCTCATG
gtaaggaacctcccactcaccacctccaactggaacagtggctgagcacactgaaactca
gccaacaggctttgaacgctctgagaagaaacaatgtggatgcttttacattcctttggt
agaatttcttacattataacaacactttgggtttttcatcaacttttatcagagagagca
EXON 13  169 bp
tcaacttttatcagagagagcaacacaacttctccgaagtttttggtggttttctttcct
actaaaagaggcttgatgggaaataatcagaataaattcattcaacattattctctctgg
agtaaatgctctctgtttcattgcctatttgtgctaatgagatggtggattatattgcag
GTAGCGTGGGGGATGCCATCTCAGTGATGGTTCCAGATGTGTACATCTCAGATGATGGGG
GTTACTCCTGGACAAAGATGCTGGAAGGACCCCACTATTACACCATCCTGGATTCTGGAG
GCATCATTGTGGCCATTGAGCACAGCAGCCGTCCTATCAATGTGATTAA
gtatgcatgaactcatctcacacacactgtctgcatagagggcaactgggggaatgttct
tcagtttattggggggatgttacagactataattcaaatttttgcatttgacagaactat
agataagattctagaaaggattgcttttaattggcaactcagattaaatggcattgtttt
EXON 14  191 bp
gagactccatctcagaaaaaaaaaaaaaaaaaaaaaaagttaaaataattgtcagccaat
aagccaccacctaaatgtaaggggttttgtctggtttgggatcaaaaagccagagtggtt
ttctgaattcccagtacacattgatcctctgtcatgatctttctgtaattgtggtttcag
GTTCTCCACAGACGAAGGTCAATGCTGGCAAACCTACACGTTCACCAGGGACCCCATCTA
TTTCACTGGCCTAGCTTCAGAACCTGGAGCTAGGTCCATGAATATCAGCATTTGGGGCTT
CACAGAATCTTTCCTGACCAGCCAGTGGGTCTCCTACACCATTGATTTTAAAGATATCCT
TGAAAGGAACT
gtgagtgtctcctttgaccttttctaccagaaacttccaagtccattttcctaaataatc
aatatggtttaatttcttttagctggaatcagcagatgcatatgcatatgaaagaggatt
gacagatgttctgtgtgggtgattaagtaatggaatggcatcagaaaaacaacctcctcc
EXON 15  190 bp
tgcgattgctagtaggctctagactagtgtaactttttgtttgcaattccaaaatgaagg
aataggttgagtcagacattcccactttccctctccttgttcttcctatagcctggcagc
tgcctcccgtgggtgggttctgtgctgtgtactttcctgaacagtgtgtctctcctttag
GTGAAGAGAAGGACTATACCATATGGCTGGCACACTCCACAGACCCTGAAGATTATGAAG
ATGGCTGCATTTTGGGCTACAAAGAACAGTTTCTGCGGCTACGCAAGTCATCCGTGTGTC
AGAATGGTCGAGACTATGTTGTGACCAAGCAGCCCTCCATCTGCCTCTGTTCCCTGGAGG
ACTTTCTCTG
gtatcagcattcctcagatttctctgtctccctttccctgttggaggaggtgaaagacag
ttttcttatagggctaacaaatattgaaatccagccgggtgcggtggctcacacctgtaa
tcccagcactttgggatgccaaggcaggcagatcacttgaggccgggagttcgagaccag
EXON 16  117 bp
ctccgtgtctgttttcctaaatcgacctccttcagaggtgtcacaggacttcctgagcta
ctttctaacaacccaagactggaatgttaaccatccactaccccacataacccttcattg
ctagtcacttaacggtcttccagctgctttgaaaggtactttatttgctgactcttgcag
TGATTTTGGCTACTACCGTCCAGAAAATGACTCCAAGTGTGTGGAACAGCCAGAACTGAA
GGGCCACGACCTGGAGTTTTGTCTGTACGGAAGAGAAGAACACCTAACAACAAATGG
gtgaggtggccttttctcccttgtcacgatggatgaggtgttcttgttcagagtgaaagc
tgcttctctccacactgagatccaagccctactttagagcactatttttggcggggttgg
ggaggggcaggatatgaaggcctccttcaagggtcaactacaggaggtgagccatgagtg
EXON 17  109 bp
aggcctgaaactacacaaaatatcccccaaaacatccctgtggacattccccccaggcct
gaaacatgacgtaaggatgggaagcttttcggcagcttttcaaatcttgtttccaagaaa
taggcaggtacccaggaatacatccttatcttctgttaccaaatcttctttgcctggtag
GTACCGGAAAATTCCAGGGGACAAATGCCAGGGTGGGGTAAATCCAGTTCGAGAAGTAAA
AGACTTGAAAAAGAAATGCACAAGCAACTTTTTGAGTCCGGAAAAACAG
gtatgttaaaataggtctagttttcaggtacaaatgggattttgtgttctgctaagaaaa
atcaaagttaaagcatcaagagttttgttactgataaaaagtggtcaaactacttctctc
aggcttcccttatacaggaagctgttagcatgaaggatgggtcatgtaacccagtgataa
EXON 18  107 bp
ataatattctcctggtaacactgagatggttcatcttggggggttggaaaagagccatca
ttaagcgcatcaggactgcagatcattcacaaagagatgaggggaatgagtggctgcctt
gacctcagtcctaggatatgcatgcctaaaacttttgtgtttgtgttttaatttctcaag
AATTCCAAGTCAAATTCTGTTCCAATTATCCTGGCCATCGTGGGATTGATGCTGGTCACA
GTCGTAGCAGGAGTGCTCATTGTGAAGAAATATGTCTGTGGGGGAAG
gtaaggaacacagaagtcaatccaaggtactgagttcaagccagaaggctgatctagggc
atatggctgagtctactcttggcaaaaactaggtacttgcagtactgttcctgaaaaatc
aggcccaaatcttctcatgtcgtacatttttcatatgtcaaccatggactgtgctttctg
EXON 19  124 bp
ttcctgaaaaatcaggcccaaatcttctcatgtcgtacatttttcatatgtcaaccatgg
actgtgctttctgtgtctgtgatgcgttcctgagtgtataaaactgagaaagtccacagt
cctgtaagaagtgcacccctgctgtgtaccaccgagtgttaaggaggtttctgttcacag
GTTCCTGGTGCATCGATACTCTGTGCTGCAGCAGCATGCAGAGGCCAATGGTGTGGATGG
TGTGGATGCTTTGGACACAGCCTCCCACACTAATAAAAGTGGTTATCATGATGACTCAGA
TGAG
gtgaggctatttcttcttgaatggtagtacccccccccccaaaaaatacaagaaaataaa
gtctgtcttctattcatgatcaagatatgccagggccaaggcgacttaatgaccataaga
tttggcaagcccagaaactaggtgattgcttttgaaataggagtgttgtggtctgtcggt
EXON 20  257 bp
gtagtacccccccccccaaaaaatacaagaaaataaagtctgtcttctattcatgatcaa
gatatgccagggccaaggcgacttaatgaccataagatttggcaagcccagaaactaggt
gattgcttttgaaataggagtgttgtggtctgtcggtaatatggtgcatgtctttttcag
GACCTCTTGGAATAGCTCTTCAGAGGAGCTGGACCCAGCATGGATGGTGGAACCACAGTA
CCTCTTACACTCCCTGTGGCTCCAACTTCAGGAAATAAATTTCCCATTGCGAGGGACCCA
GCTCTGTTTCTGCTGCTTCCATCAAAGCCAAAAGGACCTACACTAAAGAAATGCAGGGTG
GGGGTGGGGAACCCTGAGCACTTTTTTACAATTGGCTCTGAGAAAAAGGGAGACATTTTA
AATTCTTTAACTTCTTA
tttctcgtcctgtctctttgcaaagtatgggcttttttgtttttgttttttaagggaaac
gaaatggaattcgaagggaccttttcactaaccccacttctgtgtgttctgcatggcgcc
tgccccagggcatctgccaactccagtatcagctctcacagtgtacttggtaccatccct