Gene SLC27A3 Variant 1
DNA : 4.86 KbNT_079484
mRNA : 2413 bp NM_024330
CDS : 2193 bp NP_077306
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  873 bp
agatgcctaaaccgcccaagccgagaaacaacttagaagacagacataaccctgggattc
agggaaggcgcgagcaccgcccaggacctggtagggtgcgagccgcgagcagtccgggag
ggagcgcgcctagggcggagcgtaggctgtggggggagggctgggagtccggggccgccc
CACACCCGCACTCCTCCCGGGTTTCTGCTCTCCGCCCGTGTGGAGTGGTGGGGGCCTGGG
TGGGAATGGGCGTGTGCCAGCGCACGCGCGCTCCCTGGAAGGAGAAGTCTCAGCTAGAAC
GAGCGGCCCTAGGTTTTCGGAAGGGAGGATCAGGGATGTTTGCGAGCGGCTGGAACCAGA
CGGTGCCGATAGAGGAAGCGGGCTCCATGGCTGCCCTCCTGCTGCTGCCCCTGCTGCTGT
TGCTACCGCTGCTGCTGCTGAAGCTACACCTCTGGCCGCAGTTGCGCTGGCTTCCGGCGG
ACTTGGCCTTTGCGGTGCGAGCTCTGTGCTGCAAAAGGGCTCTTCGAGCTCGCGCCCTGG
CCGCGGCTGCCGCCGACCCGGAAGGTCCCGAGGGGGGCTGCAGCCTGGCCTGGCGCCTCG
CGGAACTGGCCCAGCAGCGCGCCGCGCACACCTTTCTCATTCACGGCTCGCGGCGCTTTA
GCTACTCAGAGGCGGAGCGCGAGAGTAACAGGGCTGCACGCGCCTTCCTACGTGCGCTAG
GCTGGGACTGGGGACCCGACGGCGGCGACAGCGGCGAGGGGAGCGCTGGAGAAGGCGAGC
GGGCAGCGCCGGGAGCCGGAGATGCAGCGGCCGGAAGCGGCGCGGAGTTTGCCGGAGGGG
ACGGTGCCGCCAGAGGTGGAGGAGCCGCCGCCCCTCTGTCACCTGGAGCAACTGTGGCGC
TGCTCCTCCCCGCTGGCCCAGAGTTTCTGTGGCTCTGGTTCGGGCTGGCCAAGGCCGGCC
TGCGCACTGCCTTTGTGCCCACCGCCCTGCGCCGGGGCCCCCTGCTGCACTGCCTCCGCA
GCTGCGGCGCGCGCGCGCTGGTGCTGGCGCCAG
gtaaggctggagctccgaactgactaaggcggggccagccacagaagggggcgtgtcgga
gaccacagaaaggcttggtctcatccctgggcctgggaagaagccgactatcccttgggg
ttcgaaagtgggtggagataggagtctccgggtttgagaagggatgaggctgaatctttg
EXON 2  210 bp
atctttggtgccccaaggatccccaaggagtcgagttccaggcctcagacccaagatgga
atgtccatacccttcaccctcatccaagagcagtgtgggctgggatagggaggggacatg
ggtcataggctcttctaggtagagccagggccccggcgttgtgctttcccacccttctag
AGTTTCTGGAGTCCCTGGAGCCGGACCTGCCCGCCCTGAGAGCCATGGGGCTCCACCTGT
GGGCTGCAGGCCCAGGAACCCACCCTGCTGGAATTAGCGATTTGCTGGCTGAAGTGTCCG
CTGAAGTGGATGGGCCAGTGCCAGGATACCTCTCTTCCCCCCAGAGCATAACAGACACGT
GCCTGTACATCTTCACCTCTGGCACCACGG
gtgagggccgggcaccatacttagctccccgaaaccaaggcagaggaaggcaggggtctg
ctcccagaccactccttcaaagcccccagagaggatgctgatttcattggcacatccttt
ttctccccatcatttcactccccagtctcctcacctcctactcatttctccacctccccc
EXON 3  159 bp
ctcctactcatttctccacctcccccagaccacccatatttccaggacagcctggtctcg
gtcctcagcttctgtcctgcctccgcctctttctgtgggaaacccagcgggggtgcaaac
agataggtagagcttggagtttgcccttcccctgatcgtcccataactgccaccccacag
GCCTCCCCAAGGCTGCTCGGATCAGTCATCTGAAGATCCTGCAATGCCAGGGCTTCTATC
AGCTGTGTGGTGTCCACCAGGAAGATGTGATCTACCTCGCCCTCCCACTCTACCACATGT
CCGGTTCCCTGCTGGGCATCGTGGGCTGCATGGGCATTG
gtcagtctccccaaccccaccttcattaattcatccagtagacatttattaagcacgtac
tatggtgtgagtcctccagggtagataatctagaggacggatggggcagagccctactca
ccaggagctctgtacaatagggcaatgtcacctgcctagacctacagactgaggaacggt
EXON 4  125 bp
gggacaggggccgggggaggggaaagagggccagcacggcttcctgacggtgtgactccc
acagtgggcccttcccagggaaagactacagtgatggctggggtctggaaagaggggctt
gggctccccactctgctcctaatcttacctcccttcttcccccctgcccacttctggcag
GGGCCACAGTGGTGCTGAAATCCAAGTTCTCGGCTGGTCAGTTCTGGGAAGATTGCCAGC
AGCACAGGGTGACGGTGTTCCAGTACATTGGGGAGCTGTGCCGATACCTTGTCAACCAGC
CCCCG
gtgcgtgggcacagatcctgggcagagctgctgacacagggctagctcacggggagcagg
acagttgacaggagacagggagttggagggagaagcagcaagaagaaaatggcagtgtaa
gataaggagccagagatggcctaggccatctgatgcttacggcctctgaaggaggtcaca
EXON 5  195 bp
cagcaagaagaaaatggcagtgtaagataaggagccagagatggcctaggccatctgatg
cttacggcctctgaaggaggtcacagtaggagggggttctggggaatggggaacaggaat
tcacttccgggagcgggcatcttgatgctgaagctccggcccctctcccactcatctcag
AGCAAGGCAGAACGTGGCCATAAGGTCCGGCTGGCAGTGGGCAGCGGGCTGCGCCCAGAT
ACCTGGGAGCGTTTTGTGCGGCGCTTCGGGCCCCTGCAGGTGCTGGAGACATATGGACTG
ACAGAGGGCAACGTGGCCACCATCAACTACACAGGACAGCGGGGCGCTGTGGGGCGTGCT
TCCTGGCTTTACAAG
gtgaggggcagagaggaaactgaaaacccgtggaacagcagagggctggcaggagagggg
gctcatgtgactgcaatgatccagtacccaggtctccctttccccagcatatcttcccct
tctccttgattcgctatgatgtcaccacaggagagccaattcgggacccccaggggcact
EXON 6  91 bp
agagggcaacgtggccaccatcaactacacaggacagcggggcgctgtggggcgtgcttc
ctggctttacaaggtgaggggcagagaggaaactgaaaacccgtggaacagcagagggct
ggcaggagagggggctcatgtgactgcaatgatccagtacccaggtctccctttccccag
CATATCTTCCCCTTCTCCTTGATTCGCTATGATGTCACCACAGGAGAGCCAATTCGGGAC
CCCCAGGGGCACTGTATGGCCACATCTCCAG
gttggtggtgttctggtggggtgggcggggtgctgaagctggcacaggaggactggaatt
ggagactggggtggatgggggcagaaggctctgggaaaggtgacaccactcctgaccctg
gtgactctgccaggtgagccagggctgctggtggccccggtaagccagcagtccccattc
EXON 7  199 bp
agagccaattcgggacccccaggggcactgtatggccacatctccaggttggtggtgttc
tggtggggtgggcggggtgctgaagctggcacaggaggactggaattggagactggggtg
gatgggggcagaaggctctgggaaaggtgacaccactcctgaccctggtgactctgccag
GTGAGCCAGGGCTGCTGGTGGCCCCGGTAAGCCAGCAGTCCCCATTCCTGGGCTATGCTG
GCGGGCCAGAGCTGGCCCAGGGGAAGTTGCTAAAGGATGTCTTCCGGCCTGGGGATGTTT
TCTTCAACACTGGGGACCTGCTGGTCTGCGATGACCAAGGTTTTCTCCGCTTCCATGATC
GTACTGGAGACACCTTCAG
gtatctgtccataactggtttttcatcctggacatctgatctctgtgatccaaagcttct
gaacctcaactctctaatctgccacctcaacctgggtcctaagctaatctctcattctca
gatctcaccatttcatccctgtgacactgacctctgacctcatctccccaccaagcccat
EXON 8  98 bp
tccaaagcttctgaacctcaactctctaatctgccacctcaacctgggtcctaagctaat
ctctcattctcagatctcaccatttcatccctgtgacactgacctctgacctcatctccc
caccaagcccataaggccctgacccctgactcccagtttcagatctctgctctctgacag
GTGGAAGGGGGAGAATGTGGCCACAACCGAGGTGGCAGAGGTCTTCGAGGCCCTAGATTT
TCTTCAGGAGGTGAACGTCTATGGAGTCACTGTGCCAG
gtgcctaggcatggaaggtgggggaggcacccagccaccaccccgaattggtagtacttg
ggcgcagggagcacgaggccttcgtggtggtcagccatggaggggcttactctgtctccc
acacccaccagggcatgaaggcagggctggaatggcagccctagttctgcgtccccccca
EXON 9  131 bp
gccctagattttcttcaggaggtgaacgtctatggagtcactgtgccaggtgcctaggca
tggaaggtgggggaggcacccagccaccaccccgaattggtagtacttgggcgcagggag
cacgaggccttcgtggtggtcagccatggaggggcttactctgtctcccacacccaccag
GGCATGAAGGCAGGGCTGGAATGGCAGCCCTAGTTCTGCGTCCCCCCCACGCTTTGGACC
TTATGCAGCTCTACACCCACGTGTCTGAGAACTTGCCACCTTATGCCCGGCCCCGATTCC
TCAGGCTCCAG
gtaaccggccacttcccccgccggcccctcaccccatatatcctcaccccacatatccac
cccgtgtatcaacttaggagtttgatggctcccaaactccacaaagggacccccaacgta
atacactccgtgaagagaaaaaacacggagacacaagctcttcaccccacttctttcctt
EXON 10  332 bp
ctttccttatccctgccttcttctggcctggctctttctcctccctgtcacctcctcccc
taaaccttgacctcacactccctttcccaagacttgctccttaacaaaattcaggcaact
cccctgaaccacgtgggcagagtccccttccctccaaatccctgaccctcctgtccccag
GAGTCTTTGGCCACCACAGAGACCTTCAAACAGCAGAAAGTTCGGATGGCAAATGAGGGC
TTCGACCCCAGCACCCTGTCTGACCCACTGTACGTTCTGGACCAGGCTGTAGGTGCCTAC
CTGCCCCTCACAACTGCCCGGTACAGCGCCCTCCTGGCAGGAAACCTTCGAATCTGAGAA
CTTCCACACCTGAGGCACCTGAGAGAGGAACTCTGTGGGGTGGGGGCCGTTGCAGGTGTA
CTGGGCTGTCAGGGATCTTTTCTATACCAGAACTGCGGTCACTATTTTGTAATAAATGTG
GCTGGAGCTGATCCAGCTGTCTCTGACCTACA
gtatctgtcattatctctctgtggaactgctttttccttgagagttttctcctggcgtgg
agccacaggccccacattcctgccctgactggctgtgggccagagccccgtatctggacc
ttggtgttttcctctcaggagaccctgtgtgaccttcgtccttggagaacctctggtgac